More Fields
Strain Species Genotype
PHX3250 C. elegans capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3251 C. elegans flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3252 C. elegans unc-10(syb2898 syb3252[unc-10::T2A::3xNLS::GFP]) X. Show Description
T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PHX3257 C. elegans flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3262 C. elegans nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3275 C. elegans pdf-2(syb3275[pdf-2::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. pdf-2 also known as nlp-37. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3277 C. elegans flp-13 (syb3277 [flp-13::T2A::3XNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-13 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3278 C. elegans flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX3285 C. elegans nlp-54(syb3285 [nlp-54::T2A::3xNLS::GFP]) IV. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-54 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3288 C. elegans nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3293 C. elegans bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
PHX3306 C. elegans nlp-62(syb3306[nlp-62::T2A::3XNLS::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-62 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3311 C. elegans casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
PHX3317 C. elegans flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X Show Description
CRISPR/Cas9 engineered tagged endogneous locus.
PHX3319 C. elegans nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3320 C. elegans nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3321 C. elegans ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3323 C. elegans flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3330 C. elegans pdf-1(syb3330[pdf-1::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3334 C. elegans flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3364 C. elegans eif-2D(syb3364[eif-2D::GFPnovo2::3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with GFPnovo2 and 3xFLAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
PHX3372 C. elegans rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3373 C. elegans nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3384 C. elegans nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3388 C. elegans nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3411 C. elegans nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. Show Description
Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3426 C. elegans ceh-27(syb2714[loxP] syb3286[loxP] syb3426[ceh27::GFP]) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
PHX3432 C. elegans eif-2D(syb3432[(delta)SUI1 domain +3xFLAG]) II. Show Description
Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
PHX3436 C. elegans flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3588 C. elegans flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3596 C. elegans tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX3601 C elegans pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
PHX362 C. elegans vglu-2(syb362[vglu-2::gfp]) III. Show Description
GFP tag inserted into C-terminus of endogenous vglu-2 locus. Reference: Serrano-Saiz E, et al. Genetics. 2019 Nov 27. pii: genetics.302855.2019. PMID: 31776169
PHX3634 C elegans pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3678 C elegans tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3685 C. elegans dpy-17(syb3685[dpy-17::mNG]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX3691 C. elegans sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX3936 C. elegans nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PJ1145 C. elegans ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Slight Egl.
PJ1166 C. elegans daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
PJ1182 C. elegans unc-43(n498) IV; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function. Progressive paralysis.
PJ1305 C. elegans unc-43(n498j038) IV; ccIs55; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.
PS7898 C. elegans C53C9.2(sy1116 sy1118)/tmC30 [ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. a weak allele for C53C9.2 ; 58 bp insertion from downstream sequence of its own and 1 bp deletion (leading to change of an animo acid and insertion of 19 amino acids in frame); balanced with FX30326, further confimed by genotyping for homozygotes of C53C9.2 Left flanking sequence ACCGCTGTCGGTATGCCACGTTGGAATATCACCAAG; Right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATCTG; inserted sequence between the two flanking sequence: CTCGGAGAAGACATTCTCCGACGAGGAACCGAATTCACACCATGGTACTCTGGACAAA. sgRNA : GTATCCTTGCTTCTTGTCCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS7911 C. elegans C53C9.2(sy1122)/tmC30[ubc-17(tmIs1243)] X. Show Description
Superficially wild-type. CRISPR/Cas9 STOP-IN null mutant of C53C9.2. lethal strain balanced with tmC30[ubc-17(tmIs1243)] X (from parental strain FX30236; dominant red pharynx and recessive Lon Mec); this strain segregates wild type, long animals, and L1 arrested homozygotes. Pick wild-type animals to maintain the heterozygotes. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCTGTCGGTATGCCACGTTGGAATATCACCAAGG; right flanking sequence: ACAAGAAGCAAGGATACATCGCTCCAGATCAGAGATC; inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc Reference: Wang H, et al. G3 (Bethesda).
PX356 C. remanei ssp. vulgaris C. remanei ssp. vulgaris wild isolate. Show Description
Male-female strain. Low fecundity and fitness. PX356 is an inbred strain derived from EM464. Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.
PY1466 C. elegans oyEx38. Show Description
oyEx38 [nhr-77::GFP, coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
RG3290 C. elegans rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. Show Description
Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3328 C. elegans nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. Show Description
tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW1596 C. elegans myo-3(st386) V; stEx30. Show Description
stEx30 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. stEx30 rescues myo-3(st386); animals which have lost the array arrest as 2-fold dead embryos. See also WBPaper00005628.
SHX3908 C. elegans C42D4.3(zju273[C42D4.3::8×MS2]) IV; zjuEx2144. Show Description
8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.