N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.

C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.

C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.

njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.

mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

rtEx330 [nlp-21p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtEx332 [nlp-20p::GFP + lin-15(+)]. Pick non-Muv or GFP+ to maintain.

rtEx335 [nlp-10p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.

rtEx336 [nlp-12p::GFP + lin-15(+)]. Raise at 20C or higher and pick non-Muv to maintain array.

rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.

goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.

osEx397 [cwn-1p::cwn-1::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in tail region. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

osEx393 [cwn-2p::cwn-2::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in the pharynx. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

zdIs5 [mec-4p::GFP + lin-15(+)] I. Animals contain GFP expressed in the touch neurons and have a notched head phenotype.

kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).

kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1510 (ceh-36p::die-1(cDNA) + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1510 show 2AWC(OFF) phenotype.

utEx33 [flr-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP is localized exclusively to intestinal nuclei because of the nuclear localization signal and lack of FLR-1 membrane spanning domains. Reference: Take-uchi et al.: Proc Natl Acd Sci USA. 1998 Sep 29;95(20):11775-80, Take-uchi et al.: Mol Biol Cell. 2005 Mar;16(3):1355-65, Kobayashi et al.: Genes to Cells 2011 May;16(5):565-75.

30x linker::mScarlet(dpi)::10x linker tag inserted into the C-terminus of the endogenous dpy-13 locus by CRISPR using a Cas9 RNP. Derived by modification of syb3318[dpy-13::mNG] in parental strain PHX3318, replacing mNeonGreen with the mScarlet and linkers.

mwEx32 [pat-3(YYFF) + sur-5::GFP]. Pick GFP+ to maintain. mwEx32 carries a mutant form of pat-3 gene with tyrosine (Y) to phenylalanine (F) mutations; rescues pat-3 null allele. Abnormal DTC migration. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.

GFP inserted at C terminus of endogenous pgl-1 locus. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226.

mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198.

Embryonic P granules not segregated, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3055) and meg-4(ax3052) are precise deletions of the entire coding sequence made by CRISPR/Cas9, designed to be cut again to make insertions at the endogenous locus. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283

P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

meGFP inserted between P121 and V122 of endogenous MEG-3. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226. Smith et al. Elife. 2016 Dec 3;5. pii: e21337.

tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.

20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.

3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.

3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.

qEx319 [lag-2::cMyc + rol-6(su1006)].  Rollers.  Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null).  About 70% of progeny are Lag.  Survivors are Rollers.  Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.

vxEx325 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx325 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx325 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx327 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx327 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx327 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx338 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx338 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx338 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx344 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx344 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx344 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx346 [slo-1p::hslo(D362/367A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially resistant to ethanol and crooked neck phenotype. vxEx346 expresses human BK channel protein (hslo(D362/367A + 5D5N)) with compromised calcium-sensing residues and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx350 [slo-1p::slo-1(5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partial crooked neck phenotype. vxEx350 expresses worm BK channel protein (slo-1(5D5N)) with purported calcium-sensing residues in the calcium bowl compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx358 [slo-1p::slo-1(D391/396A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Crooked neck phenotype. vxEx358 expresses worm BK channel protein (slo-1(D391/396A + 5D5N)) with purported calcium-sensing residues compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx383 [myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Resistant to the effects of ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx345 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx345 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx345 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx328 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx328 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx328 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx339 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx339 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx339 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.