FX30123 |
C. elegans |
tmC24 [F23D12.4(tmIs1233)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30126 |
C. elegans |
tmC1 X. Show Description
Break points: In(F53B1.2 unc-18 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2.1..8.5) Lon Unc Mec. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
FX30133 |
C. elegans |
tmC3 V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30134 |
C. elegans |
tmC3 [egl-9(tmIs1228)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30135 |
C. elegans |
tmC3 [egl-9(tmIs1230)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30138 |
C. elegans |
tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30140 |
C. elegans |
tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Balancer marked with myo-2p::Venus. Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30143 |
C. elegans |
tmC6 II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30144 |
C. elegans |
tmC6 [dpy-2(tm9710)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30151 |
C. elegans |
tmC9 IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30152 |
C. elegans |
tmC12 [egl-9(tmIs1194)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30153 |
C. elegans |
tmC12 [egl-9(tmIs1197)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30154 |
C. elegans |
tmC12 V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30161 |
C. elegans |
tmC16 [unc-60(tmIs1237)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::mCherry. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30162 |
C. elegans |
tmC16 V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30164 |
C. elegans |
tmC16 [unc-60(tm9712)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30166 |
C. elegans |
tmC18 I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30167 |
C. elegans |
tmC18 [dpy-5(tmIs1200)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30168 |
C. elegans |
tmC18 [dpy-5(tmIs1236)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30176 |
C. elegans |
tmC20 I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30177 |
C. elegans |
tmC20 [unc-14(tmIs1219)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. tmIs1219 is inserted in unc-14, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30179 |
C. elegans |
tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30185 |
C. elegans |
tmC24 X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30186 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::mCherry. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30194 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30197 |
C. elegans |
tmC25 IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) One breakpoint is in unc-8, but Unc phenotype is not detectable. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30203 |
C. elegans |
tmC25 [unc-5(tmIs1241)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30205 |
C. elegans |
tmC27 I. Show Description
Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30208 |
C. elegans |
tmC27 [unc-75(tmIs1239)] I. Show Description
Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30218 |
C. elegans |
tmC30 [ubc-17(tmIs1247)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30225 |
C. elegans |
tmIn65 I; lig-4(tm750) III. Show Description
Break points: In(dnj-27 dkf-1) I. Covered region (Mb) 1.8 (11.9..13.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30229 |
C. elegans |
tmC30 X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30233 |
C. elegans |
tmC16 [unc-60(tmIs1210)] V. Show Description
Break points: In(flp-34 C04E6.7 In(srbc-66 T10H9.8)) V. Covered region (Mb) 5.6 (1..6.7) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30234 |
C. elegans |
tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30235 |
C. elegans |
tmC20 [dpy-5(tm9709)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30236 |
C. elegans |
tmC30 [ubc-17(tmIs1243)] X. Show Description
Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30237 |
C. elegans |
tmC24 [unc-9(tm9723)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30238 |
C. elegans |
tmC18 [dpy-5(tm9705)] I. Show Description
Break points: In(B0207.10 dnj-27 In(gsp-3 sre-23)) I. Covered region (Mb) 7.2 (4.7..11.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30240 |
C. elegans |
tmC24 [F23D12.4(tmIs1240)] X. Show Description
Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30252 |
C. elegans |
tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X; tmEx4950. Show Description
tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30253 |
C. elegans |
tmC24 [F23D12.4(tmIs1233) unc-9(tm9718)] X; tmEx4950. Show Description
tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30257 |
C. elegans |
tmC25 [unc-5(tm9708)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30258 |
C. elegans |
tmC27 [unc-75(tm9711)] I. Show Description
Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30262 |
C. elegans |
lin-42(tmIs1246) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30266 |
C. elegans |
lin-42(tmIs1226) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30269 |
C. elegans |
dpy-9(tm9713) kvs-5(tmIs1245) IV. Show Description
Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30273 |
C. elegans |
egl-17(tmIs1224) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::Venus. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30276 |
C. elegans |
egl-17(tmIs1234) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::mCherry. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
GLW39 |
C. elegans |
ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
|
|
GLW41 |
C. elegans |
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
|
|