More Fields
Strain Species Genotype
CGC171 C. elegans mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC172 C. elegans mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC179 C. elegans mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
CGC180 C. elegans mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
CX2205 C. elegans odr-3(n2150) V. Show Description
Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che).
DA2202 C. elegans daf-7(e1372) III; adEx2202. Show Description
adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
DM7221 C. elegans pha-1(e2123) III; raEx221. Show Description
raEx221 [F25D7.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7222 C. elegans pha-1(e2123) III; raEx222. Show Description
raEx222 [M18.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7223 C. elegans pha-1(e2123) III; raEx223. Show Description
raEx223 [Y54E5A.5::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7226 C. elegans raEx226. Show Description
raEx226 [B0303.2 ORF::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
DM7228 C. elegans pha-1(e2123) III; raEx228. Show Description
raEx228 [Y43E12A.2::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7229 C. elegans pha-1(e2123) III; raEx229. Show Description
raEx229 [F13B12.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
EG1470 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.
EG9747 C. elegans oxSi1106 II; unc-119(ed3) III. Show Description
oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9876 C. elegans unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9881 C. elegans unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9882 C. elegans F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9885 C. elegans W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9887 C. elegans W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9888 C. elegans W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9891 C. elegans unc-119(ox819) III; W03F9.11(oxTi1121) V. Show Description
oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(flexon)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
HA300 C. elegans lin-15B&lin-15A(n765) X; rtEx223. Show Description
rtEx223 [nlp-6p::GFP + lin-15(+)]. Maintain at 20C or warmer. Pick GFP+ non-Muv to maintain. Reference: Nathoo AN, et al. Proc Natl Acad Sci U S A. 2001 Nov 20;98(24):14000-5.
HA307 C. elegans lin-15B&lin-15A(n765) X; rtEx224. Show Description
rtEx224 [F18E9.2::GFP + lin-15(+)]. Maintain by picking non-Muv. Maintain at 20C.
HS1294 C. elegans unc-76(e911) V; osEx225. Show Description
osEx225 [scm::dsh-2::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
HS1325 C. elegans unc-76(e911) V; osEx229. Show Description
osEx229 [pry-1::GFP + unc-76(+)]. This strain expresses functional pry-1::GFP driven by the pry-1 promoter. In the seam cells, just prior to the onset of mitosis, pry-1::GFP localizes to the anterior cortex.
IG358 C. elegans oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
JH1288 C. elegans cdk-7(ax224) I. Show Description
Temperature sensitive lethal. Maintain at 15C.
NC574 C. elegans wdIs22. Show Description
wdIs22 [acr-5p::YFP + rol-6(su1006)]. Integrated array derived from wdEx223. Maintain by picking Rollers.
QX2263 C. sp. 27 Caenorhabditis sp. 27 wild isolate. Show Description
Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.
SD1822 C. elegans unc-119(ed3) III; gaEx229. Show Description
gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
SD1904 C. elegans unc-119(ed3) III; gaEx220. Show Description
gaEx220 [sod-3p::mCherry + aakg-2(sta2) + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1905 C. elegans unc-119(ed3) III; gaEx223. Show Description
gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1968 C. elegans unc-119(ed3) III; gaEx224. Show Description
gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1973 C. elegans unc-119(ed3) III; gaEx225. Show Description
gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1976 C. elegans unc-119(ed3) III; gaEx228. Show Description
gaEx228 [Y62H9A.6::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational Y62H9A.6::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1981 C. elegans unc-119(ed3) III; gaEx226. Show Description
gaEx226 [D1054.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational D1054.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SD1983 C. elegans unc-119(ed3) III; gaEx227. Show Description
gaEx227 [C08F11.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational C08F11.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
SV2071 C. elegans he317[eft-3p::Lox2272::egl-13-NLS::tagBFP2::let-858 3'UTR::Lox2272::egl-13-NLS::mCherry::let-858 3'UTR] IV; heSi220 X. Show Description
heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.