| PX736 |
C elegans |
fxSi13 III. Show Description
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
|
|
| QX2263 |
C. sp. 27 |
Caenorhabditis sp. 27 wild isolate. Show Description
Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.
|
|
| SD1822 |
C. elegans |
unc-119(ed3) III; gaEx229. Show Description
gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
|
|
| SD1904 |
C. elegans |
unc-119(ed3) III; gaEx220. Show Description
gaEx220 [sod-3p::mCherry + aakg-2(sta2) + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1905 |
C. elegans |
unc-119(ed3) III; gaEx223. Show Description
gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1968 |
C. elegans |
unc-119(ed3) III; gaEx224. Show Description
gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
|
|
| SD1973 |
C. elegans |
unc-119(ed3) III; gaEx225. Show Description
gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
|
|
| SD1976 |
C. elegans |
unc-119(ed3) III; gaEx228. Show Description
gaEx228 [Y62H9A.6::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational Y62H9A.6::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
|
|
| SD1981 |
C. elegans |
unc-119(ed3) III; gaEx226. Show Description
gaEx226 [D1054.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational D1054.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
|
|
| SD1983 |
C. elegans |
unc-119(ed3) III; gaEx227. Show Description
gaEx227 [C08F11.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational C08F11.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.
|
|
| SV2071 |
C. elegans |
he317[eft-3p::Lox2272::egl-13-NLS::tagBFP2::let-858 3'UTR::Lox2272::egl-13-NLS::mCherry::let-858 3'UTR] IV; heSi220 X. Show Description
heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.
|
|