BC3840 |
C. elegans |
sDf69(s2298) unc-22(s7) lev-1(x22)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
BP175 |
C. elegans |
eff-1(hy21) II; hyEx22. Show Description
hyEx22 [hsp16-2::eff-1 + ajm-1::GFP + rol-6(su1006)]. Temperature sensitive eff-1 mutation (worms are cell fusion-defective at 25C; cell fusion defects are less penetrant at 15C). AJM-1 marks epithelial junctions. Pick GFP+ Rollers to maintain.
|
|
EJ374 |
C. elegans |
gon-2(dx22) fer-1(hc1) unc-29(e1072) I. Show Description
Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ.
|
|
SAL144 |
C. elegans |
pha-1(e2123) III; denEx22. Show Description
denEx22 [K08D8.5::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
|
|
VL674 |
C. elegans |
unc-119(ed3) III; wwEx22. Show Description
wwEx22 [mir-269p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
XE1089 |
C. elegans |
sup-17(n316) I; oxIs12 X; wpEx22. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx22 [myo-3p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Muscular expression of SUP-17 from wpEx22 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.
|
|
ZX299 |
C. elegans |
lin-15B&lin-15A(n765) X; zxEx22. Show Description
zxEx22 [myo-3p::ChR2(H134R)::YFP + lin-15(+)].
|
|
AGD466 |
C. elegans |
uthEx222. Show Description
uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
|
|
AGK587 |
C. elegans |
armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
BC5055 |
C. elegans |
sEx223. Show Description
sEx223 [BO336 (III) + pCes1943[rol-6(su1006)]]. segrgnt A. 10 ng/ul BO336 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
BC5058 |
C. elegans |
sEx226. Show Description
sEx226 [C13B9 (III) + pCes1943[rol-6(su1006)]]. segrgnt C. 20 ng/ul CB13B9 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.
|
|
CF1595 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
|
|
CGC102 |
C. elegans |
mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by myo-2p::wrmScarlet. Generated in parental strain N2. Rollers. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC103 |
C. elegans |
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + lox2272]) V. Show Description
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet.
|
|
CGC104 |
C. elegans |
mir-61(umn16[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC102, leaving disrupted mir-61 locus.
|
|
CGC110 |
C. elegans |
mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC111 |
C. elegans |
mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
|
|
CGC112 |
C. elegans |
mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
|
|
CGC113 |
C. elegans |
mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC114 |
C. elegans |
mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet.
|
|
CGC115 |
C. elegans |
mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
|
|
CGC120 |
C. elegans |
mir-792(umn31[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-792 pre-miRNA deletion strain deletion allele in which mir-792 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC121 |
C. elegans |
mir-785(umn32[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-785 pre-miRNA deletion strain deletion allele in which mir-785 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC131 |
C. elegans |
mir-248(umn41[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC132 |
C. elegans |
mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) III. Show Description
mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC141 |
C. elegans |
mir-1821(umn48[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-1821 pre-miRNA deletion allele in which mir-1821 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC142 |
C. elegans |
mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC143 |
C. elegans |
mir-1021(umn50[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) IV. Show Description
mir-1021 pre-miRNA deletion allele in which mir-1021 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC144 |
C. elegans |
mir-1022(umn51[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1022 pre-miRNA deletion allele in which mir-1022 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC145 |
C. elegans |
mir-1824(umn52[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1824 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC146 |
C. elegans |
mir-800(umn53[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-800 pre-miRNA deletion allele in which mir-800 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC147 |
C. elegans |
mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC148 |
C. elegans |
mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC149 |
C. elegans |
mir-81(umn56[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC150 |
C. elegans |
mir-1829.3&F39B1.3(umn57[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])X. Show Description
mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC151 |
C. elegans |
mir-1829.2(umn58[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC154 |
C. elegans |
mir-4812(umn61[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC169 |
C. elegans |
mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC170 |
C. elegans |
mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC171 |
C. elegans |
mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC172 |
C. elegans |
mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC177 |
C. elegans |
lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
|
|
CGC179 |
C. elegans |
mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CGC180 |
C. elegans |
mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CX2205 |
C. elegans |
odr-3(n2150) V. Show Description
Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che).
|
|
DA2202 |
C. elegans |
daf-7(e1372) III; adEx2202. Show Description
adEx2202 [gpa-4p::daf-7 + rol-6p::GFP]. Rescues Daf-c. Maintain by picking GFP+. Reference: You et al (2008) Cell Metab 7(3):249-57.
|
|
DM7221 |
C. elegans |
pha-1(e2123) III; raEx221. Show Description
raEx221 [F25D7.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7222 |
C. elegans |
pha-1(e2123) III; raEx222. Show Description
raEx222 [M18.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7223 |
C. elegans |
pha-1(e2123) III; raEx223. Show Description
raEx223 [Y54E5A.5::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7226 |
C. elegans |
raEx226. Show Description
raEx226 [B0303.2 ORF::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.
|
|