Type A Egl. Males abnormal-fused rays. See also WBPaper00002235.

Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.

twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

mNeonGreen and AID tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

mNeonGreen and AID tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).

GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.

GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.

mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.

T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

syIs6 [hsp-16.41p::lin-3]. Chromosomal insertion of the extrachromosomal array syEx23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Fertile Unc-38. sy326 has no phenotype on its own. Suppresses sterility of let-23(sy10) and lin-3(n1058). Sterile in double mutant combination with lfe-1 alleles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).

ytEx209 contains [pRM8 (mel-46+) + pTG96(sur-5::GFP)]. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. Culture at 20°C or higher in order not to lose the transgene. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.

ytEx211 contains [pRM8(mel-46+) + pTG96(sur-5::GFP)]. Larval lethal. GFP minus worms die or arrest as L4 larvae.

Male-female strain. Maintain by mating. Isolated from garden soil in Buenos Aires, Argentina on 3/2/2012.

Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).

stEx14 [pat-10::LacZ + rol-6(su1006)]. Pick Rollers to maintain. Animals with the extrachromosomal array are Slow Rollers. Animals which have lost the array are Pats. Strain can be propagated by chunking.

denEx21 [F55G11.7::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

denEx22 [K08D8.5::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

denEx24 [clec-85p::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

denEx26 [F08G5.6::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

denEx28 [F10A3.4::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

gaEx231 [imp-2(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of IMP-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.

gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.

gaEx230 [sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.

gaEx214 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx216 [sod-3p::mCherry + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx218 [sod-3p::mCherry + aakg-2(sta2) + lys-1p::lyz(D. rerio) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx220 [sod-3p::mCherry + aakg-2(sta2) + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.

gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.

gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.

gaEx224 [W03F11.1::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational W03F11.1::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx225 [F13G11.3::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational F13G11.3::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx228 [Y62H9A.6::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational Y62H9A.6::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaEx226 [D1054.11::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational D1054.11::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.