pdeEx2 [pCE-bJUN-VN173 + pCE-bFOSdeltaZIP-VC155 + rol-6(su1006)]. Pick Rollers to maintain. Heat-shock induces protein expression but NO BiFC complementation.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

rexEx2 [ges-1p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in the intestine and red fluorescence (mRFP) in touch-receptor neurons.

uonEx2 [unc-54::CFP::YFP(Venus)]. No additional transformation marker was included in the array. uonEx2 also known as CV in reference publications. Lifespan and pharyngeal pumping rates are similar to N2. This is a high-FRET positive control strain for use in conjunction with DDP1. Because the CFP and YFP protein sequences are covalently fused together (and show little evidence of cleavage), FRET should be high and largely invariant since both fluorescent moieties are always in close proximity. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.

uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1 forms a weaker gradient in the cytoplasm of the one-cell zygote than in wild-type. Reference: Han et al, Current Biology 2017.

fphEx2 [aak-2A/Cp::aak-2A/C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A and aak-2C isoforms expressed from their own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

orEx2 [mlc-4p::mlc-4(genomic coding)::GFP::unc-54 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. Rollers are GFP+.

Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'

WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]

weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.

jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

zuEx2 [W02B9(cosmid) + rol-6(su1006). Maintain by picking Rollers.

lstEx2 [pdf-1p::pdf-1::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. pdf-1 over-expressing line with wild-type locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.

otIs92 [flp-10::GFP]. Derived by integration of ynEx2.

kfEx2 [plc-1(+) + sur-5::GFP]. Pick GFP+ animals to maintain. plc-1(rx1) homozygotes are semi-Sterile. Animals with the array have normal brood size. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.

Temperature sensitive. Maintain at 15C.

denEx2 [lys-7::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

mnEx2 [mec-8(+) + rol-6(su1006)]. Rollers. Pick rollers to maintain.

gtEx2[CEP-1::GFP + unc-119(+)]. GFP expression in germ line of adult worms (20-40 hours post L4) in the late pacytene area in the nucleus. Also expression in alae and a few nuclei in the pharynx. Compound microscope needed to see staining. Maintain by picking non-Unc.

baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.

utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

rmIs190 [F25B3.3p::Q67::CFP]. hdEx2 [snb-1::ALKBH3(H257A)::BFP::tbb-2 3’UTR + rol-6(su1006)]. Pick Rollers to maintain. BFP fused to the C-terminus of catalytically inactive ALKBH3(H257A) mutant form of ALKBH3. Pan-neuronal CFP expression. Reference: Sun Y, et al. Nature. 2023 Nov;623(7987):580-587. doi: 10.1038/s41586-023-06701-5. PMID: 37938769.

uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthEx299 [aak-2 (genomic aa1-aa321)::GFP::unc-54 3'UTR + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.

armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.

zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.

zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.

dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10.

dbEx722 [flp-17p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in BAG. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971

kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971

acEx26 [odr-1p::RFP]. Pick RFP+ to maintain. RFP expression in AWC and AWB. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971

eEx25 [C13G4(cosmid) + XDM23(phage)]. Animals with eEx25 are WT. Pick wild-type to maintain. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). This cosmid lacks the 3' end of the unc-22 gene while XDM23 lacks the 5' end of unc-22, but following injection an extrachromosomal array was formed that included at least one functional unc-22 gene.

uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.

uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.

sEx20063[rCesF44E5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Heterozygotes are WT and segregate WT, Vul and dead eggs. Hets twitch in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.