sEx579 [R02E12 (X) + pCes1943[rol-6(su1006)]]. 10 ng/ul R02E12 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

sEx794 [C14E2 (X) + pCes1943[rol-6(su1006)]]. 10 ng/ul C14E2 + 90 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

sEx714 [F57E5 (X) + pCes1943[rol-6(su1006)]]. 21 ng/ul F57E5 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

sEx726 [F49E7 (X) + pCes1943[rol-6(su1006)]]. 20 ng/ul F49E7 + 80 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

GFP knocked into C terminal of vit-2 gene by CRISPR/Cas9 using self-excising drug selection cassette method of Dickinson et al. (2015, Genetics). Strain is derived from BCN9070, which was outcrossed to remove a linked background mutation on LG X causing transgenic males to mate poorly. Reference: Perez MF, et al. Nature. 2017 Dec 7;552(7683):106-109.

Left-handed Dpy Roller. Recessive.

Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.

Temperature sensitive. Left hand Roller and Dpy at 25C. Wild-type at 16C. Recessive.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, Mortal germline (Mrt) at 25C. Expressing nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Maintain at 15C. Heritable RNAi deficient, germ granule defective, high sterility. Expresses nuclear GFP in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germline granules defective, ~30% sterility. Males fail to be attracted by hermaphrodite-secreted volatile sex pheromones. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343

inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.

F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.

Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.

vrIs13 [vrk-1p::VRK-1:GFP:VRK3UTR + unc-119(+)]. F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.

bqIs51 [pie-1p::GFP::npp-5 + unc-119(+)] IV. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Expresses GFP::NPP-5 and mCherry in the germ line. Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl; bqIs51 transgene rescues the npp-5(tm3039) phenotype. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT with dim GFP in the pharynx and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.

bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in intestinal cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in intestinal cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632

Endogenous maph-1.1 locus tagged with GFP using CRISPR/Cas9. Animals are homozygous viable and express GFP::maph-1.1 ubiquitously. Reference: Waaijers S, et al. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. PMID: 27506200

Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836.

byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

byEx1375 [endu-2p::endu-2::eGFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene rescues mortal germline (Mrt) phenotype of endu-2(tm4977). Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.

ozEx76 [cdk-4p::CDK-4::GFP + sur-5::DsRed)]. Maintain by picking DsRed+. ozEx76 is unstable; strain exhibits high levels of lethality and sterilty. ~10% of progeny are fertile. Reference: Fox PM, et al. Development. 2011 Jun;138(11):2223-34.

Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.

Primers used to detect the deletion: IQ789.E1: CACACATCGGTCTTCCACAC. IQ789.E2: AATGAAACACCGGAAACTCG. IQ789.I1: TGCAATTGTGTTGCAGGAAT. IQ789.I2: AAAAGAGTGGCTGGCTCGTA.

F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.

Him. Reference: Vogel BE, Hedgecock EM. (2001) Development. 128:883-94.

Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).

ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressing line from injection of constructs ZC421 and pTG98.

Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.

waEx15 [fat-7::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.

Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.