wwIs36 [ins-29p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx79 [ins-30p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx80 [ins-32p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx81 [ins-33p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs39 [ins-35p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwIs40 [ins-37p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx83 [ins-38p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx84 [ins-39p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx82 [ins-36p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )

bpIs239 [W07G4.5p::W07G4.5::GFP + unc-76(+)]. W07G4.5::GFP is expressed in the intestine. A few GFP aggregates are formed in wild-type embryos at the four-fold stage; the number of aggregates is dramatically increased in epg-7 and atg-3 mutants. Reference: Lin L, et al. J Cell Biol. 2013 Apr 1;201(1):113-29.

bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. Him. In wild-type embryos, sqst-1::GFP is very weakly expressed and diffusely localized in the cytoplasm. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.

Heterozygotes are wild type and segregate wild type heterozygotes, paralyzed DpyUncs, and Uncs with germline tumors. Pick WT and check segregation of progeny to maintain. Reference: Vaid S, et al. Development. 2013 Apr;140(8):1645-54.

weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.

jcpSi3 [ins-37p::ins-37::eGFP::ins-37 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi12 [W04G5.8p::W04G5.8::eGFP::W04G5.8 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.

Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

mwEx443 [pat-3(+) + sur-5::GFP]. Pick GFP+ to maintain. mwEx443 contains wild type contains pat-3 genomic DNA, rescues pat-3 null allele. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.

Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superficially wild-type.

axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82.

axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.

axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.

Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58.

Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, mid-larval lethals (hT1 homozygotes), males and dead eggs. Mutation in pop-1 results in the MS blastomere adopting the fate of the E blastomere. pop-1 mutant embryos have twice the amount of wild type gut and only make anterior pharynx. him-5 is outside the region balanced by hT2.

zuIs145 [nmy-2p::mom::GFP + unc-119(+)]. Wild type phenotype.

zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.

zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.

zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.

Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Segregates wild-type hets, Ste dx40 homozygotes, and Dpy Uncs. Maintain by picking wild-type and checking for correct segregation. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.

qIs54 [pes-10p::GFP + myo-2p::GFP + F22B7.9::GFP]. Superficially wild-type. GFP expression in pharynx, gut and early embryos. qIs54 males mate, but not as well as wild-type. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.