More Fields
Strain Species Genotype
HT1774 C. elegans unc-119(ed3) III; wwIs36. Show Description
wwIs36 [ins-29p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1780 C. elegans unc-119(ed3) III; wwEx79. Show Description
wwEx79 [ins-30p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1785 C. elegans unc-119(ed3) III; wwEx80. Show Description
wwEx80 [ins-32p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1788 C. elegans unc-119(ed3) III; wwEx81. Show Description
wwEx81 [ins-33p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1798 C. elegans unc-119(ed3) III; wwIs39. Show Description
wwIs39 [ins-35p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1803 C. elegans unc-119(ed3) III; wwIs40. Show Description
wwIs40 [ins-37p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1806 C. elegans unc-119(ed3) III; wwEx83. Show Description
wwEx83 [ins-38p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT1809 C. elegans unc-119(ed3) III; wwEx84. Show Description
wwEx84 [ins-39p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT2098 C. elegans unc-119(ed3) III; wwEx82. Show Description
wwEx82 [ins-36p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HT2099 C. elegans unc-119(ed3) III; wwEx85. Show Description
wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
HW1826 C. elegans lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
HZ1569 C. elegans bpIs239. Show Description
bpIs239 [W07G4.5p::W07G4.5::GFP + unc-76(+)]. W07G4.5::GFP is expressed in the intestine. A few GFP aggregates are formed in wild-type embryos at the four-fold stage; the number of aggregates is dramatically increased in epg-7 and atg-3 mutants. Reference: Lin L, et al. J Cell Biol. 2013 Apr 1;201(1):113-29.
HZ589 C. elegans him-5(e1490) V; bpIs151. Show Description
bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. Him. In wild-type embryos, sqst-1::GFP is very weakly expressed and diffusely localized in the cytoplasm. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.
IT540 C. elegans gap-3(kp1) I; puf-8(zh17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild type and segregate wild type heterozygotes, paralyzed DpyUncs, and Uncs with germline tumors. Pick WT and check segregation of progeny to maintain. Reference: Vaid S, et al. Development. 2013 Apr;140(8):1645-54.
JA1403 C. elegans unc-119(e2498) III; weIs15. Show Description
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.
JCP301 C. elegans jcpSi3 II; unc-119(ed3) III. Show Description
jcpSi3 [ins-37p::ins-37::eGFP::ins-37 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP341 C.elegans jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP343 C. elegans jcpSi12 II; unc-119(ed3) III. Show Description
jcpSi12 [W04G5.8p::W04G5.8::eGFP::W04G5.8 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP378 C. elegans jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP383 C. elegans jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP387 C. elegans jcpSi24 II; unc-119(ed3) III. Show Description
jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP394 C. elegans jcpSi31 II; unc-119(ed3) III. Show Description
jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP405 C. elegans jcpSi37 II; unc-119(ed3) III. Show Description
jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP462 C. elegans ints-6(jcp1[ints-6::3xFLAG]) IV. Show Description
3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JDW389 C. elegans bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW460 C. elegans noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW834 C. elegans unc-119(kst33) col-97(wrd346[col-97::internal mNG::3xFLAG + unc-119(+)]) III. Show Description
Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JE443 C. elegans pat-3(st564) III; mwEx443. Show Description
mwEx443 [pat-3(+) + sur-5::GFP]. Pick GFP+ to maintain. mwEx443 contains wild type contains pat-3 genomic DNA, rescues pat-3 null allele. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.
JEL1000 C. elegans hsr-9(xoe17) I. Show Description
Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
JEL1134 C. elegans polq-1(xoe51) III. Show Description
Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
JGG1 C. elegans Y53F4B.4(tm3898) II. Show Description
Superficially wild-type.
JH1986 C. elegans unc-119(ed3) III; axIs1437. Show Description
axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH1999 C. elegans unc-119(ed3) III; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Superficially wild-type. Reference: Merritt C, et al. Curr Biol. 2008 Oct 14;18(19):1476-82.
JH2099 C. elegans unc-119(ed3) III; axIs1486. Show Description
axIs1486 [pCG51; LAP::Y46G5A.13(tia-1.2) + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2100 C. elegans unc-119(ed3) III; axIs1487. Show Description
axIs1487 [pCG81; pie-1p::LAP::patr-1 + unc-119(+)]. GFP expression appears in cytoplasmic granules in P1-Z2/Z3 lineages; nuclear & cytoplasmic in other blastomeres. Maintain @ 25C; array is unstable and will silence after several generations. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JH2471 C. elegans unc-119(ed3) III; axIs1775. Show Description
axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.
JH3614 C. elegans par-1(ax4202[par-1(T983A)]) V/nT1[qIs51] (IV;V); meg-3(ax3054[meg-3::meGFP]) X. Show Description
meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3619 C.elegans par-1(ax4208[meGFP::delta-KA1]) V/nT1[qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118
JH3678 C. elegans mex-5(ax3050[mCherry::mex-5])/nT1[qIs51] IV; par-1(ax4209[par-1(T983A)::meGFP])/nT1[qIs51] V. Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.
JIN1375 C. elegans hlh-30(tm1978) IV. Show Description
Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58.
JJ1057 C. elegans pop-1(zu189) dpy-5(e61)/hT1 I; him-5(e1490)/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, mid-larval lethals (hT1 homozygotes), males and dead eggs. Mutation in pop-1 results in the MS blastomere adopting the fate of the E blastomere. pop-1 mutant embryos have twice the amount of wild type gut and only make anterior pharynx. him-5 is outside the region balanced by hT2.
JJ1992 C. elegans unc-119(ed3) III; zuIs145. Show Description
zuIs145 [nmy-2p::mom::GFP + unc-119(+)]. Wild type phenotype.
JJ2059 C. elegans unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2060 C. elegans unc-119(ed3) III; zuIs236. Show Description
zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2061 C. elegans unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JK1389 C. elegans mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2208 C. elegans gld-2(dx40)/dpy-5(e61) unc-13(e51) I. Show Description
Segregates wild-type hets, Ste dx40 homozygotes, and Dpy Uncs. Maintain by picking wild-type and checking for correct segregation. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2505 C. elegans cyd-1(q626) II; him-5(e1490) V. Show Description
Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.
JK2735 C. elegans qIs54 X. Show Description
qIs54 [pes-10p::GFP + myo-2p::GFP + F22B7.9::GFP]. Superficially wild-type. GFP expression in pharynx, gut and early embryos. qIs54 males mate, but not as well as wild-type. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2751 C. elegans sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.