egxSi157 [mex-5p::tomm-20::Dendra2::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of TOMM-20 tagged with photoconvertible Dendra2 on the outer membranes of mitochondria in the germline and embryos. Reference: Fan X, et al. G3 (accepted).

lwEx27 [inx-3::GFP]. inx-3(lw68) embryos display a wide range of developmental defects. All L1s that manage to hatch have a Pun (pharynx unattached) phenotype. inx-3::GFP transgene rescues lw68 to wild-type. Pick L2s or later to maintain. Reference: Starich, et al., 2003. Dev. Biol. 256:403.

Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.

WT strain, Pellioditis pelhamensis. See WBG 12(5)14. Male/Female strain. Previously and incorrectly called Rhabditis maupasi by the CGC. Also previously called DF5039.

WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418. Formerly known as Oscheius myriophila.

WT strain, Pelodera teres. See WBG 12(5) 14. Male/Female strain. Previously called DF5016.

Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx2 [aak-2A/Cp::aak-2A/C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A and aak-2C isoforms expressed from their own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx4 [vha-6p::aak-2A::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A isoform expressed from the intestinal vha-6 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

orIs19 [pie-1::GFP::dylt-1 + unc-119(+)]. Superficially wild-type. Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Superficially wild-type. mKate2 was inserted into the C-terminus of ebp-2 endogenous locus. Reference: Sugioka K, et al. (2018) PNAS, Jan 30;115(5): E954-E963. (PubMed ID: 29348204)

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpy, and sterile tm1296 homozygotes. Dev Biol. 2010 Aug 15;344(2):758-71.

Temperature-sensitve sterile. Maintain at 15-20C. Superficially wild-type at permissive temperatures; contains large bubble-like structures on the inside in all stages (described as large early endosomes), reduced brood size. Sterile and very sick at 25°C with some single escapers that are sterile and sick themselves. Suppressors have been observed after long culturing over several months, periodically check for sterility at 25C.

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

xnIs3[par-6:PAR-6::GFP + unc-119(+)]. Wild type worms. Express PAR-6::GFP in early embryos and epithelial cells.

xnIs78 [cdc-42p::2xHA::cdc-42 + unc-119(+)]. Superficially wild-type. Reference: Anderson DC, et al. (2008) Science 320(5884):1771-4.

Superficially wild type. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1). Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpy (tmIn14 homozygotes), and unc-15 homozygotes. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24D1.1 Heterozygotes are wild-type and segregate wild-type heterozygotes, unc-55 homozygotes, and sqv-5 homozygotes (sterile, clear, sickly). Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes segregate wild-type heterozygotes, Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Superficially wild-type.

Superficially wild-type.

Superficially wild-type.

Superficially wild-type.

wuIs177 [ftn-1p::GFP + lin-15(+)]. GFP expression in the intestine. ftn-1p::GFP transgene shows moderate basal expression under standard culture conditions in an otherwise wild-type background, but is strongly induced by reduced insulin/IGF-1 signalling, reduced HIF signalling, and increased free iron levels. References: Ackerman D & Gems D. PLoS Genet. 2012;8(3):e1002498. Valentini S, et al. Mech Ageing Dev. 2012 May;133(5):282-90.

Him. Wild-type heterozygotes segregate WT heterozygotes and Dpy Unc ccz-1 homozygotes (produce only arrested embryos). ccz-1 embryos have spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Wild type at 15C. Embryonic lethal at 25C. Temperature sensitive phase during embryogenesis. sup-35 mutations may (and have) occurred spontaneously in this strain. This can be checked by shifting the worms to 25C: pha-1 animals should be dead while sup-35 pha-1 animals will live.

Him. Wild-type heterozygotes segregate WT heterozygotes and Dpy Unc ccz-1 homozygotes (produce only arrested embryos). ccz-1 embryos have spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Wild type at 15C. Maternal effect embryonic lethal at 25C. Temperature sensitive period in oocyte and early embryogenesis.

Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'

Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'