umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7144 and CGC92. hd7144 is a 5280 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTGAAGAATAGCAGCAAAAACGGTCACCT; Right flanking sequence: ATTACTTTTTTTTAAAAAGTACAGTATCAA. sgRNA #1: ACAGGTGTTTACAATGCGAG; sgRNA #2: TATTTTCTTACAGTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vkEx2620 [nhx-2p::aman-2::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing AMAN-2::CemOrange2 under the intestinal-specific nhx-2 promoter. AMAN-2 is localized to the Golgi. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2664 [nhx-2p::CemOrange2::tram-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::TRAM-1 under the intestinal-specific nhx-2 promoter. TRAM-1 is localized to the ER. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2666 [nhx-2p::CemOrange2::rab-7 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-7 under the intestinal-specific nhx-2 promoter. RAB-7 is localized to the late endosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2671 [nhx-2p::CemOrange2::rab-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-5 under the intestinal-specific nhx-2 promoter. RAB-5 is localized to the late endosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2674 [nhx-2p::CemOrange2::pisy-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::PISY-1 under the intestinal-specific nhx-2 promoter. PISY-1 is localized to the ER. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2688 [nhx-2p::CemOrange2::cup-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::CUP-5 under the intestinal-specific nhx-2 promoter. CUP-5 is localized to the lysosome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkIs2697 [nhx-2p::lmp-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing LMP-1::CemOrange2 under the intestinal-specific nhx-2 promoter. LMP-1 is localized to the lysosome. Integrated; chromosome unknown. Reference: Thomas

vkEx2700 [nhx-2p::CemOrange2::SKL + myo-2p::GFP]. Wild-type animals expressing CemOrange2::SKL under the intestinal-specific nhx-2 promoter. The SKL motif (signal peptide) localizes to the peroxisome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2702 [nhx-2p::mtCemOrange2 + myo-2p::GFP]. Wild-type animals expressing MT::CemOrange2 under the intestinal-specific nhx-2 promoter. The MT motif (signal peptide) localizes to the mitochondria. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2728 [nhx-2p::sqst-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing SQST-1::CemOrange2 under the intestinal-specific nhx-2 promoter. SQST-1 is localized to the autophagasome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2733 [nhx-2p::NLS-SV40::CemOrange2::NLSegl-13 + myo-2p::GFP]. Wild-type animals expressing NLS(sv-40)::CemOrange2::NLS(egl-13) under the intestinal-specific nhx-2 promoter. The dual NLS localizes to the nucleus. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkIs2734 [nhx-2p::lmn-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing LMN-1::CemOrange2 under the intestinal-specific nhx-2 promoter. LMN-1 is localized to the nuclear lamin. Integrated; chromosome unknown. Reference: Thomas

vkEx2735 [nhx-2p::glo-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing GLO-1::CemOrange2 under the intestinal-specific nhx-2 promoter. GLO-1 is localized to the lysosome related organelle. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2738 [nhx-2p::CemOrange2::lgg-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::LGG-1 under the intestinal-specific nhx-2 promoter. LGG-1 is localized to the autophagasome. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2748 [nhx-2p::CemOrange2::tram-1 + nhx-2p::GFP::KDEL]. Wild-type animals expressing CemOrange2::TRAM-1 and GFP::KDEL under the intestinal-specific nhx-2 promoter. Pick GFP+ to maintain Reference: Thomas

vkIs2749 [nhx-2p::lmp-1::CemOrange2 + nhx-2p::GFP::ATZ + nhx-2p::mKate2::lgg-1 + myo-2p::GFP + myo-2p::mCherry]. Wild-type animals expressing LMP-1::CemOrange2, GFP::ATZ, and mKate2::LGG-1 under the intestinal-specific nhx-2 promoter. Integrated; chromosomes unknown. Reference: Thomas

vkEx2755 [nhx-2p::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing CemOrange2 under the intestinal-specific nhx-2 promoter. Free CemOrange2 is localized to the cytosol. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2756 [nhx-2p::CemCardinal2 + myo-2p::GFP]. Wild-type animals expressing CemCardinal2 under the intestinal-specific nhx-2 promoter. Free CemCardinal2 is localized to the cytosol. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx2757 [nhx-2p::CemNeptune2.5 + myo-2p::RFP]. Wild-type animals expressing CemNeptune2.5 under the intestinal-specific nhx-2 promoter. Free CemNeptune2.5 is localized to the cytosol. Pick animals with RFP+ pharynx to maintain. Reference: Thomas

vkIs2797 [nhx-2p::CemOrange2::rab-5 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::RAB-5 under the intestinal-specific nhx-2 promoter. RAB-5 is localized to the early endosome. Integrated; chromosome unknown. Reference: Thomas

vkIs2799 [nhx-2p::glo-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing GLO-1::CemOrange2 under the intestinal-specific nhx-2 promoter. GLO-1 is localized to the lysosome related organelle. Integrated; chromosome unkown. Reference: Thomas

vkIs2877 [nhx-2p::sqst-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing SQST-1::CemOrange2 under the intestinal-specific nhx-2 promoter. SQST-1 is localized to the autophagasome. Integrated; chromosome unknown. Reference: Thomas

vkIs2878 [nhx-2p::CemOrange2::lgg-1 + myo-2p::GFP]. Wild-type animals expressing CemOrange2::LGG-1 under the intestinal-specific nhx-2 promoter. LGG-1 is localized to the autophagasome. Integrated; chromosome unknown. Reference: Thomas

vkIs2881 [nhx-2p::glo-1::CemOrange2 + ges-1p::glo-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and GLO-1::GFP under the Pnhx-2 and Pges-1 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkIs2882 [nhx-2p::glo-1::CemOrange2 + vha-6p::lmp-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and LMP-1::GFP under the Pnhx-2 and Pvha-6 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas

vkEx2883 [nhx-2p::aqp-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing AQP-1::CemOrange2 under the intestinal-specific nhx-2 promoter. AQP-1 is localized to the aprical and basal PM. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

vkEx3160 [nhx-2p::abt-4::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

vkEx3161 [nhx-2p::abt-4(L162P)::mKate2 + nhx-2p::CemOrange2::tram-1]. Wild-type animals expressing both ABT-4(L162P)::mKate2 and CemOrange2::TRAM-1 under the nhx-2 intestinal specific promoter. Pick mKate2+ & CemOrange2+ animals to maintain.

wwEx34 contains [hlh-31::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

wwIs3 [mir-236::GFP + unc-119(+)]. Wild-type.

wwEx52 [nhr-86p::GFP + unc-119(+)]. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwIs6 [mir-255p::GFP + unc-119(+)]. Wild type.

wwIs4 [mir-238p::GFP + unc-119(+)]. Wild type.

wwEx47 [hlh-30::GFP + unc-119(+)]. Pick wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs5 [mir-240-786p::GFP + unc-119(+)]. Wild type.

wwIs15 [mir-63p::GFP + unc-119(+)]. Wild-type.

wwIs18 [mir-79p::GFP + unc-119(+)]. Wild type.

wwIs8 [mir-35-41p::GFP + unc-119(+)]. Wild-type.

wwIs11 [mir-47p::GFP + unc-119(+)]. Wild type.

wwIs9 [mir-392p::GFP + unc-119(+)]. Wild type.

wwIs17 [mir-76p::GFP + unc-119(+)]. Wild type.

wwEx52 [nhr-86p::GFP + unc-119(+)]. Him. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwEx50 contains [ref-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

wwIs16 [mir-75p::GFP + unc-119(+)]. Wild type.

wwEx33 [mir-232p::GFP + unc-119(+)]. Wild type.