C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.

dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.

juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.

Superficially wild-type. Reference: Zhou K, et al. Cell Reports 2017 May 9;19(6):1117-1129. PMID: 28494862

juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.

CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.

Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263

Wild type.

Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]

mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.

Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

Superficially wild-type. Strong defects in axon regeneration. Maintain under normal conditions. Reference: Yan D, et al. Cell. 2009 Sep 4;138(5):1005-18.

Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.

Clumps. Found in strain RC301. See 1987 Worm Meeting Abstract Book page 162. npr-1 pka bor-1.

Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.

0006. Rhabditella axei. Male/Female strain. Isolated by W. Sudhaus on July 29, 1979 from a compost heap in Esmoulieres, France. Grown easily on OP50 at 16-25C. See WBG 12(5) 14.

Metarhabditis blumi wild isolate. Formerly known as Rhabditis blumi. Isolated by J.P. Blum in April 1971 in a dung heap near Valencia, Spain. Gonochoristic. Grows well at 16-24C on OP50. Forms dauer larvae on overcrowded and starved plates. Freezes easily with C. elegans protocols with 80% viability.

0012. Male/Female strain. Isolated by M. Velasquez in the spring of 1989 from a June beetle larva (Scarabaeidae) near Quetzaltenango, Guatemala. WBG 12(5) 14. Formerly known as Rhabditoides regina.

0013. Pelodera strongyloides. Male/Female strain. See WBG 12(5) 14. Originally came from Sudhaus.

WT strain. Mesorhabditis longespiculosa. Isolated by W. Sudhaus on August 16, 1973 from tunnels of beetle larvae (Mallodon downesi?, Cerambycidae) in Euphorbiaceae at lake Nakuru, Kenya. See WBG 12(5) 14. Male/Female strain.

WT strain. Rhabditis (Oscheius) dolichuroides. Isolated by W. Sudhaus in April 1978 from decaying matter in a hole in a tree in Malindi, Kenya. See WBG 12(5) 14. Male/Female strain.

Robin Giblin-Davis MUST be cited in any publication. Isolated by R. Giblin-Davis from the palm weevil Rhynchphorus cruentatus (Curculionidae) in Broward County, Florida. Male/Female strain. See WBG 12(5) 14.

0020. Formerly known as Rhabditis (Rhabditis) myriophila. Taxonomy ID: 281680 Isolated by G. O. Poiner (see Poiner, 1986).

WT strain, Pelodera strongyloides. Isolated in April 1948 from pustules in the skin of a cow with dermatitis in central Illinois (see Levine et al 1950). Gonochoristic. May cause dermatitis in mammals (such as domesticated animals, and, rarely, humans). Grows well at 16-24C on OP50. Dauer larvae are the infective stage and are thermotactic. Freezes easily with C. elegans protocols with 70% viability. Previously called Pelodera strongyloides dermatitica by the CGC.

WT strain. Rhabditis (Pellioditis) typica. Male/Female strain. Isolated by W. Sudhaus on Sept. 3, 1973 from feces of an antelope in Tsavo National Park, Kenya. See WBG 12(5) 14. Formerly known as Rhabditis (Pellioditis) typica.

WT strain. Oscheius sp. See WBG 12(5) 14. Male/Female strain. Collected by a Belgian expedition to the Galapagos archipelago. From Gaetan Borgonie, Gent University, Belgium.

Male/Female strain. Pelodera strongyloides. See WBG 12(5) 14. Originally came from Victor Ambros.

NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.

20x inbred line derived from DF5077. Male-female strain. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.

Isofemale line. Isolated from a rotten lemon collected at Chan Chich Lodge in the town of Gallon Jug, Orange Walk, Belize (17.56399°N, 89.046282°W) on 11/15/12.

Male-female strain. 20x inbred line derived from TMG13. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.

Superficial wild type. DG3430 was segregated from DG3373 [sacy-1(tn1385) I; acy-4(ok1806) V]. Reference: Kim S, et al. 2012 Genetics

tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics

Segregates WT GFP+ heterozygotes, non-GFP sacy-1(tm5503) sterile animals, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Kim S, et al. 2012 Genetics

tnEx195 [inx-8(+) + inx-9(+) + sur-5::GFP]. Pick GFP+ animals to maintain. Animals carrying tnEx195 are wild-type; animals that have lost the array are sterile and produce few germ cells. Reference: Starich TA, Hall DH, Greenstein D. Genetics. 2014 Nov;198(3):1127-53.

Apparently wild type