More Fields
Strain Species Genotype
CX11262 C. elegans Show Description
C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.
CX11264 C. elegans Show Description
C. elegans wild isolate. Reference: Andersen EC, et al. Nat Genet. 2012 Jan 29;44(3):285-90.
CX11271 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11276 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11285 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11292 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11307 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11314 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CX11315 C. elegans Show Description
Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
CYA19 C. elegans dvIs19 III; rexEx11. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.
CZ1566 C. elegans lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ17515 C. elegans juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ1774 C. elegans vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ19982 C. elegans mcu-1(ju1154) IV. Show Description
Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.
CZ20310 C. elegans juSi164 unc-119(ed3) III. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.
CZ20473 C. elegans ncs-2(ju836) I. Show Description
Superficially wild-type. Reference: Zhou K, et al. Cell Reports 2017 May 9;19(6):1117-1129. PMID: 28494862
CZ22714 C. elegans miro-3(ju1310) juSi271 I; miro-1(ju1306) IV; miro-2(ju1309) X. Show Description
juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.
CZ26389 C. elegans esyt-2(ju1408) III. Show Description
CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.
CZ26606 C. elegans vwa-8(ju1659) X. Show Description
Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263
CZ2744 C. elegans adm-4(ok265) X. Show Description
Wild type.
CZ27593 C. elegans bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
CZ29001 C. elegans muIs32 II; degt-1(ok3307) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]
CZ29114 C. elegans bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
CZ4280 C. elegans eps-8(jc36)/unc-26(e205) dpy-4(e1166) IV. Show Description
Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.
CZ5686 C. elegans vab-1(e2027) ptp-3(mu256)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ8920 C. elegans cebp-1(tm2807) X. Show Description
Superficially wild-type. Strong defects in axon regeneration. Maintain under normal conditions. Reference: Yan D, et al. Cell. 2009 Sep 4;138(5):1005-18.
DA2250 C. elegans mgl-2(tm355) I; mgl-1(tm1811) X. Show Description
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
DA650 C. elegans Show Description
Clumps. Found in strain RC301. See 1987 Worm Meeting Abstract Book page 162. npr-1 pka bor-1.
DAW1 Panagrolaimus sp. Show Description
Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.
DF5006 Rhabditella axei Show Description
0006. Rhabditella axei. Male/Female strain. Isolated by W. Sudhaus on July 29, 1979 from a compost heap in Esmoulieres, France. Grown easily on OP50 at 16-25C. See WBG 12(5) 14.
DF5010 Metarhabditis blumi Metarhabditis blumi wild isolate. Show Description
Metarhabditis blumi wild isolate. Formerly known as Rhabditis blumi. Isolated by J.P. Blum in April 1971 in a dung heap near Valencia, Spain. Gonochoristic. Grows well at 16-24C on OP50. Forms dauer larvae on overcrowded and starved plates. Freezes easily with C. elegans protocols with 80% viability.
DF5012 Rhomborhabditis regina Rhomborhabditis regina wild isolate. Show Description
0012. Male/Female strain. Isolated by M. Velasquez in the spring of 1989 from a June beetle larva (Scarabaeidae) near Quetzaltenango, Guatemala. WBG 12(5) 14. Formerly known as Rhabditoides regina.
DF5013 Pelodera strongyloides Show Description
0013. Pelodera strongyloides. Male/Female strain. See WBG 12(5) 14. Originally came from Sudhaus.
DF5017 Mesorhabditis longespiculosa Show Description
WT strain. Mesorhabditis longespiculosa. Isolated by W. Sudhaus on August 16, 1973 from tunnels of beetle larvae (Mallodon downesi?, Cerambycidae) in Euphorbiaceae at lake Nakuru, Kenya. See WBG 12(5) 14. Male/Female strain.
DF5018 Oscheius dolichuroides Show Description
WT strain. Rhabditis (Oscheius) dolichuroides. Isolated by W. Sudhaus in April 1978 from decaying matter in a hole in a tree in Malindi, Kenya. See WBG 12(5) 14. Male/Female strain.
DF5019 Teratorhabditis palmarum Teratorhabditis palmarum wild isolate. Show Description
Robin Giblin-Davis MUST be cited in any publication. Isolated by R. Giblin-Davis from the palm weevil Rhynchphorus cruentatus (Curculionidae) in Broward County, Florida. Male/Female strain. See WBG 12(5) 14.
DF5020 Oscheius myriophilus Oscheius myriophilus wild isolate. Show Description
0020. Formerly known as Rhabditis (Rhabditis) myriophila. Taxonomy ID: 281680 Isolated by G. O. Poiner (see Poiner, 1986).
DF5022 Pelodera strongyloides Show Description
WT strain, Pelodera strongyloides. Isolated in April 1948 from pustules in the skin of a cow with dermatitis in central Illinois (see Levine et al 1950). Gonochoristic. May cause dermatitis in mammals (such as domesticated animals, and, rarely, humans). Grows well at 16-24C on OP50. Dauer larvae are the infective stage and are thermotactic. Freezes easily with C. elegans protocols with 70% viability. Previously called Pelodera strongyloides dermatitica by the CGC.
DF5025 Reiterina typica Reiterina typica wild isolate. Show Description
WT strain. Rhabditis (Pellioditis) typica. Male/Female strain. Isolated by W. Sudhaus on Sept. 3, 1973 from feces of an antelope in Tsavo National Park, Kenya. See WBG 12(5) 14. Formerly known as Rhabditis (Pellioditis) typica.
DF5033 Oscheius dolichura Show Description
WT strain. Oscheius sp. See WBG 12(5) 14. Male/Female strain. Collected by a Belgian expedition to the Galapagos archipelago. From Gaetan Borgonie, Gent University, Belgium.
DF5040 Pelodera strongyloides Show Description
Male/Female strain. Pelodera strongyloides. See WBG 12(5) 14. Originally came from Victor Ambros.
DF5070 C. sp. 2 Show Description
NOTE: To freeze this strain, heat shock at 37°C for 1 hr and add CaCl2 2mM in freezing solution.
DF5112 C. drosophilae Caenorhabditis drosophilae wild isolate. Show Description
20x inbred line derived from DF5077. Male-female strain. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.
DF5152 C. sp. 30 Show Description
Isofemale line. Isolated from a rotten lemon collected at Chan Chich Lodge in the town of Gallon Jug, Orange Walk, Belize (17.56399°N, 89.046282°W) on 11/15/12.
DF5173 C. sp. 8 Show Description
Male-female strain. 20x inbred line derived from TMG13. Heat shock 2.5-3.0 hrs at 30C immediately prior to freezing.
DG3430 C. elegans sacy-1(tn1385) I. Show Description
Superficial wild type. DG3430 was segregated from DG3373 [sacy-1(tn1385) I; acy-4(ok1806) V]. Reference: Kim S, et al. 2012 Genetics
DG3485 C. elegans sacy-1(tm5503) I; tnEx159. Show Description
tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics
DG3492 C. elegans sacy-1(tm5503) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sacy-1(tm5503) sterile animals, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Kim S, et al. 2012 Genetics
DG3614 C. elegans inx-8(tn1474) inx-9(ok1502) IV; tnEx195. Show Description
tnEx195 [inx-8(+) + inx-9(+) + sur-5::GFP]. Pick GFP+ animals to maintain. Animals carrying tnEx195 are wild-type; animals that have lost the array are sterile and produce few germ cells. Reference: Starich TA, Hall DH, Greenstein D. Genetics. 2014 Nov;198(3):1127-53.
DG4105 C. elegans lfor-1(tn1652) lfor-2(tn1653) II. Show Description
Apparently wild type