More Fields
Strain Species Genotype
CB4555 C. elegans Show Description
Wild isolate from Pasadena, Ca. [Flower bed on CIT campus in summer of 1971 (or 1973??). Wild type phenotype. High copy Tc1. Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. CB subclone of PA1 (Tc1 pattern HCG?).
CB4760 C. elegans fem-1(e2044) mor-2(e1125) unc-24(e158) fem-3(q20) / unc-5(e53) dpy-20(e1282) IV Show Description
Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CB4851 C. elegans C. elegans wild isolate. Show Description
Wild type-slightly Unc. Tc1 pattern high copy; different from RW7000. Bergerac isolate obtained by S. Brenner from Brun group. Caenorhabditis elegans wild isolate. CB subclone of Bergerac N62 (Tc1 pattern HCB). To obtain ECA243, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4852 C. elegans Show Description
Wild type. Low Tc1 copy number; pattern X. [Obtained from Rothamsted by S. Brenner as 'Panagrellus redivivus'. Cross fertile with C. elegans N2.] Caenorhabditis elegans wild isolate. CB subclone of N3 (Tc1 pattern X).
CB4853 C. elegans C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1; pattern III. Caenorhabditis elegans wild isolate. CB subclone of GA-12 (Tc1 pattern III). To obtain ECA245, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4854 C. elegans Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1, pattern V. Caenorhabditis elegans wild isolate. CB subclone of GA-9 (Tc1 pattern V).
CB4855 C. elegans C. elegans wild isolate. Show Description
NOTE: Whole-genome analysis indicates that this stock is genotypically CB4858. Users interested in this strain are encouraged to obtain a verified CB4855-derivied strain. To obtain ECA247, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org. Isolated from compost in Palo Alto, CA in 1982(?). Wild type (plg-1(e2001)). Low copy Tc1, pattern VI. Caenorhabditis elegans wild isolate CB subclone of Sta-5 (Tc1 pattern VI). Original stock isolated by T. Doniach.
CB4856 C. elegans Show Description
Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.]
CB4857 C. elegans C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4858 C. elegans C. elegans wild isolate. Show Description
Isolated from Caltech flowerbed in the summer of 1971 (1973??) in Pasadena, CA. Wild type. Low copy Tc1; pattern XI. Caenorhabditis elegans wild isolate. EM subclone of PA1 (Tc1 pattern XI). To obtain ECA251, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4869 C. elegans Show Description
Hermaphrodites are WT at all stages. Adult males abnormal with swollen distorted bursal anatomy. Male mating efficiency is zero. Natural mutation present in original KR314 isolate.
CB4932 C. elegans Show Description
Wild isolate with unique Tc1 pattern. Bor phenotype. Isolated by P.S. Grewal before 1991, from mushroom farm near Taunton, England. Sent to Ann Burnell in 1991. Sent from Burnell to J. Hodgkin in Jan. 1992. Sent to CGC in Jan. 1997. Caenorhabditis elegans wild isolate.
CB6452 C. elegans dpy-25(e817) II; xol-1(y9) X. Show Description
Severe dumpy; dominant, hence crossing with wild-type males yields dumpy hermaphrodites and dead eggs (dpy-25/+; xol-1/0).
CB6710 C. elegans unc-119(ed3) III; eEx650. Show Description
eEx650 [ilys-3p::GFP + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter transgene for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB6712 C. elegans unc-119(ed3) III; eEx652. Show Description
eEx652 [ilys-1p::DsRed2 + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter for ilys-1Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB6725 C. elegans unc-119(ed3); eEx655. Show Description
eEx655 [ilys-2p::CFP; unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transgenic animals carry ilys-2 transcriptional reporter. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB6737 C. elegans clec-69&clec-70(ok2061) IV. Show Description
No obvious phenotype, apparently wild-type sensitivity to pathogens. Derivative of RB1663, further out-crossed into wild-type background. Reference: O’Rourke et al. (2005) PMID: 16809667.
CB6738 C. elegans lys-7(ok1384) V. Show Description
Gross phenotype wildtype, increased sensitivity to some bacterial pathogens. Derivative of RB1285, further out-crossed into wild-type background. References: O’Rourke et al. (2005) PMID: 16809667. Gravato-Nobre et al. (2016) PMID: 27525822.
CB6746 C. elegans mif-1(ok2009) III. Show Description
No obvious phenotype, normal sensitivity to bacterial pathogens. Derived from RB1633; further out-crossed into wild-type background. Reference: O’Rourke et al. (2005) PMID: 16809667.
CB6761 C. elegans unc-119(ed3); eEx665. Show Description
eEx665 [trf-1p::dsRed2 + unc-119(+)]. Pick wild-type to maintain. Transcriptional reporter for trf-1. Reference: Wang et al. (2015) PMID: 26687621.
CB6772 C. elegans clec-50(ok2455) V. Show Description
No obvious phenotype, apparently normal sensitivity to bacterial pathogens. Derived from RB1897; further out-crossed into wild-type background. References: O’Rourke et al. (2005) PMID: 16809667. D J O'Rourke and J Hodgkin, unpublished.
CB6786 C. elegans unc-119(ed3) III; eEx671. Show Description
eEx671 [ilys-5p::GFP; unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transcriptional reporter for ilys-5. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB7171 C. elegans tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). Show Description
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).
CB7212 C. elegans unc-119(ed3) III; eEx781. Show Description
eEx781 [ilys-6p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Transcriptional reporter for ilys-6. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB7248 C.elegans dpy-18(e499)/subs-4(e3026) III; wIs78 IV. Show Description
wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. Heterozygous strain. Wild-type hermaphrodites segregating wild-type, Dpy-18, and dead eggs (subs-4 homozygotes). Pick wild-type to maintain. Reference: Gravato-Nobre et al (in preparation).
CB7401 C. elegans unc-119(ed3) III; bah-2(gk487599) IV; eEx835. Show Description
eEx835 [bah-2(+) + unc-119(+)]. Pick wild-type to maintain. bah-2(gk487599) rescued by transgene. Reference: O'Rourke et al (in preparation).
CB7471 C. elegans unc-119(ed3) III; bus-8A(lj22) X; eEx861. Show Description
eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).
CC1 C. elegans Show Description
Continuously cultured in liquid CeMM for 4 years.
CC2 C. elegans Show Description
N2 stock which was flown on STS-107, shuttle Columbia.
CC3 C. elegans Show Description
This strain was grown on CeMM (C. elegans Maintenance Medium) for 3 years (called CC1). It was then flown on STS-107, shuttle Columbia (and now called CC3).
CE1494 C. elegans +/hT2 [dpy-18(h662)] I; pen-2(ep220)/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CER250 C. elegans ubh-4(cer25[F73V]) II. Show Description
Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CER344 C. elegans ubh-4(cer32[A87D]) II. Show Description
Superficially wild-type. ubh-4(cer32[A87D]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CER7 C. elegans rsr-2(tm2607) II. Show Description
Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
CF2892 C. elegans sEx10466. Show Description
sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2893 C. elegans sEx11128. Show Description
sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF702 C. elegans muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Superficially wild-type. Reference: Ch'ng, Q et al. (2003) Geneteics 164:1355-67.
CFJ302 C. elegans unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)
CGC1 C. elegans C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
CGC105 C. elegans hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC138 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC139 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC194 C. elegans dpy-26(n199)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Lethal/sterile dpy-26 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus n199 homozygotes (variable morphology). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Derived by crossing parental strains FX30140 with CB5101 (males).
CGC20 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC23 C. elegans dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC28 C. elegans +/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC29 C. elegans unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC30 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.