| GLW41 |
C. elegans |
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
|
|
| JR1279 |
C. elegans |
cep-1(+) I; cep-1(w40). Show Description
Resistant to germ cell death induced by ionizing radiation. Sensitive to hypoxia and starvation stresses. This strain contains an intact copy of the gene at the normal locus on LG I. w40 is a translocated partially deleted copy of the cep-1 locus that has a dominant-negative effect on cep-1 function and is not linked to the chromosomal location of cep-1.
|
|
| JT529 |
C. elegans |
ndg-4(sa529) III. Show Description
Ndg: nordihydroguairetic acid resistant. Nrf: nose resistant to fluoxetine-induced hypercontraction. Pale eggs. Accumulates yolk. Some embryonic lethality. Nonsense mutation W404stop(UGA).
|
|
| OH1571 |
C. elegans |
tax-2(ot25) otIs114 I; him-5(e1490) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele.
|
|