More Fields
Strain Species Genotype
RG3197 C. elegans Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.