| RG3177 |
C. elegans |
T21B10.3(ve677[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 4525 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adult animals that lay dead eggs (ve677 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gctcgtaacagcaaaATGAATAATCCAGAA ; Right flanking sequence: attgaattcgtatttttttccattccacat. sgRNA #1: TCTGTTACAGCGCTTTCTTC; sgRNA #2: aaaaatacgaattcaatggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|