| RG3541 |
C. elegans |
+/mT1 [umnIs52] II; spe-21(ve1041[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| RG3551 |
C. elegans |
coa-5(ve1051[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[umnIs78 unc-54(h1040)] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Sterile. Deletion of 1100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1051 homozygotes), and Unc non-GFP mKate2+ animals (hIn1 [umnIs78 unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+mKate2+. Left flanking Sequence: GAAATTCCCAAAAGCCGAATCCACAGGCCC; Right flanking sequence: ATGACGGCTTCGCATTTTACTTTTAAACTT. coa-5 crRNA A: TATCATCGTATCGCTAAGCT; coa-5 crRNA B: CGTTATCGATTCTGCGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|