More Fields
Strain Species Genotype
MT1853 C. elegans unc-86(n843) III. Show Description
Him. Lethargic. Mec. Egl.
MT1855 C. elegans unc-86(n844) III. Show Description
Unc. Egl. Non-Him.
MT1857 C. elegans unc-86(n845) III. Show Description
Unc. Non-him.
MT1859 C. elegans unc-86(n846) III. Show Description
Unc.
MT1861 C. elegans unc-86(n847) dpy-19(e1259) III. Show Description
Unc-Lethargic. Mec. Egl. ts Dpy. n847 has a Him phenotype.
MT1862 C. elegans unc-86(n848) III. Show Description
Unc. Temperature sensitive allele.
MT1976 C. elegans unc-86(n946) III. Show Description
HSN-. Egl. Mec.
MT2150 C. elegans lin-31(n301) unc-85(e1414) II. Show Description
Muv. Unc.
MT306 C. elegans unc-86(n306) III. Show Description
Bloated. Mec. Egl. Him.
MT3743 C. elegans unc-84(e1410) osm-11(n1604) X. Show Description
MT4552 C. elegans unc-74(e883) bli-4(e937) unc-87(e1459) I. Show Description
Blistered Uncs.
MT4917 C. elegans unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. Show Description
MT5259 C. elegans unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. Show Description
MT5260 C. elegans unc-86(n946) ced-7(n1892) unc-50(e306) III. Show Description
MT9056 C. elegans nDf20 III; nDp2 [unc-86(e1416)] (III;f). Show Description
Segregates Unc-86 animals and dead eggs.
OH10425 C. elegans otIs337. Show Description
otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
OH11620 C. elegans otIs429; otIs337. Show Description
otIs429 [pag-3(fosmid)::mChOpti + ttx-3::GFP]. otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
OH12734 C. elegans unc-86(n846) III; otEx5851. Show Description
otEx5851 [unc-86(fosmid)::NLS::mChopti + lin-44::YFP]. Pick YFP+ to maintain.
OH12737 C. elegans uIs115; otIs14; otEx5853. Show Description
uIs115 [mec-17::RFP]. otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers. otEx5853 [hsp::unc-86 + ttx-3::mCherry]. Temperature-sensitive. Maintain at 15C. Pick ttx-3::mCherry-positive animals to maintain array. Expresses unc-86 ubiquitously upon heat shock.
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
OH17513 C. elegans unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OP476 C. elegans unc-119(tm4063) III; wgIs476. Show Description
wgIs476 [unc-86::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
PS3818 C. elegans unc-68(r1158) him-5(e1490) V; syEx475. Show Description
syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.
RB1186 C. elegans unc-89(ok1116) I. Show Description
C24G7.5 Homozygous. Outer Left Sequence: GTCCACGTCAAGAGCACTCA. Outer Right Sequence: GACTCGAGCTCTTCGCTGAT. Inner Left Sequence: GAAAACCTGGATTCTTGCCA. Inner Right Sequence: GAACTGGCGACTTTTTGAGC. Inner Primer PCR Length: 3199. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW1350 C. elegans unc-44(e362) unc-82(e1323)/stDf7 IV. Show Description
Segregates heterozygotes that display only the unc-82 phenotype: slow but normal movement, disorganized muscle structure, somewhat Egl. stDf7 homozygotes die as embyros. unc-44 unc-82 homozygotes generally die as coiled, poorly-moving larvae.
RW1523 C. elegans unc-87(e843) unc-54(s95) I. Show Description
Unc. unc-87 affects muscle thin filaments. unc-54(s95) is a missense myosin heavy chain mutation that assembles properly but does not function well in contraction.
RW1524 C. elegans unc-87(e1459) unc-54(s95) I. Show Description
Unc. unc-87 affects muscle thin filaments. unc-54(s95) is a missense myosin heavy chain mutation that assembles properly but does not function well in contraction.
RW3562 C. elegans unc-44(e362) deb-1(st555)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs (unc-82 unc-24 homozygotes) and dead eggs (unc-44 deb-1 homozygotes).
RW3563 C. elegans egl-19(st556)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Pats. Maintain by picking WT and checking for correct segregation of progeny. st556 pka pat-5.
RW85 C. elegans unc-89(st85) I. Show Description
VC1192 C. elegans unc-89(ok1659) I. Show Description
C09D1.1. Superficially wild type. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1201 C. elegans unc-89(ok1658) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C09D1.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1658 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 1274 bp. Deletion left flank: TCCTATCATCTATTTCATTCGATCAAACAA. Deletion right flank: ATTTTGGGGGGGGGGGGGGGCAGAAATCGG. Breakpoints should be confirmed; deletion may also involve insertion and/or rearrangement of sequence between external left and internal left primers. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1690 C. elegans unc-85(ok2125) II. Show Description
F10G7.3. External left primer: TTCGAAATCGATTGAAACCC. External right primer: GCTCGAGAGGCTGCTTTAGA. Internal left primer: TCCGTTCGAAATTTCCTGTT. Internal right primer: CCCCGTGTCTTTCATTGATT. Internal WT amplicon: 2106 bp. Deletion size: 1708 bp. Deletion left flank: TGGAAAAATAAATAAATAAATACGAAGAAG. Deletion right flank: AGTAAAGAAATTGATTTAAAAAGAAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2535 C. elegans unc-82(gk1124) IV. Show Description
B0496.3. Identified by PCR, validated by CGH. External left primer: GATGTTGTCGCATTGTGTCC. External right primer: AACTTGATGGATCTGGTGGC. Internal left primer: TGCGCTTCTAATCGTAAGGC. Internal right primer: GGTTCCTCGTCAGGATCAAA. Internal WT amplicon: 2549 bp. Deletion size: 595 bp. Deletion left flank: AGAAACTAGACATAAATCAAGGTATTACTT. Deletion right flank: ACTAAAAGTAAAGGTTACAATTCCAAATTA. Insertion Sequence: AAATAGACATAAATCAAGGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3121 C. elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
XA3702 C. elegans npr-2(ok419) IV; unc-80(pd48) V. Show Description
Sequence across the breakpoint i: ggccattagcagaagtacgaaaattaaaactctcagaggtggaa. unc-80(pd48) allele identified 3/2008 by Neline Kriek.