Unc-weak coiler, especially in reverse; moves forward well; sluggish; short.

Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Unc. Eat.

Dauer defective. Unc.

Dauer defective. Dpy. Unc. Leaky.

Heterozygotes are WT and segregate WT, Hmr inviable embyros and Egl Unc. Hmr: Hammerhead - defective hypodermal enclosure, especially in anterior regions; approximately 2% of zu389 embryos enclose normally and are Hmp [Humpback: defective body elongation, abnormal bulges on dorsal side]. See also WBPaper00005031. Received new stock from Allison Lynch in the Hardin lab 3/2009.

Wild-type phenotype. Segregates WT, Unc-54 (hIn1[unc-54] homozygotes), dead eggs (hDf15 homozygotes). Pick WT and check for correct segregation of progeny to maintain. See WBG 14: 29. This deletion was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose. CGC received new stock 9/3/97.

Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).

Heterozygotes are WT and segregate WT, Uncs, and severely Lumpy arrested L1s (ok817). m1 can easily get lost through recombination.

Heterozygotes are WT. Segregate Dpy Uncs. Segregate L1 lethal: starved, uncoordinated, defective pharyngeal basement membrane.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Heterozygotes are Rollers and segregate Rollers, Hmr inviable embyros and Egl Unc. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

Heterozygotes are Srf and grow slowly. Hets segregate Srf, DpyUncSrf and dead eggs. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. CGC rec'd new stock 10/99.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.

WT phenotype. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

otEx304 [unc-75p::GFP + rol-6(su1006)]. 5kb upstream of promoter of unc-75 cloned into pPD95.75. Expressed pan neuronally. Pick Rollers to maintain.