Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.

Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.

dzDf1 [IV:506328 - 698511 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+ and segregate into dead eggs (dzDf1 homozygotes), wild-type GFP+ (Heterozygotes), and Unc (tmC25 homozygotes).

Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

lqIs250 [unc-5::GFP + gcy-32::CFP]. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405.

lqIs294 [unc-25p::myr::unc-5 + gcy-32p::YFP]. VD/DD axon guidance defects. YFP expression in AQR, PQR and URXL/R. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405. doi: 10.1242/dev.110437. PMID: 25371370.

2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.

Suppresses touch receptor axon guidance defect of mec-7::unc-5.

evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.

Homozygous sterile. Deletion of 4404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve687 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ATTTCGGCGCTGTTCCAGACGCTGTCGGCG ; Right flanking sequence: aggcactgtgcgcagttttggttcccgcaa. sgRNA #1: TGACAATCAAATCGACTTCC; sgRNA #2: caattttctagaatttccca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile, Pvl. Deletion of 5370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve691 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tctcttttcagctggaaactgtaaactcct ; Right flanking sequence: TGGGCGATTTTAGCATATCTTCCATGGAAT. sgRNA #1: ttatttaacttcctatctca; sgRNA #2: aactcacTTATACAAGTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous sterile. Deletion of 3719 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve762 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aggacgaaaatcgaattctccgcgattttt ; Right flanking sequence: tatgagctgaagaatattttaaaatagaac. sgRNA #1: cgctcctgggcaccgaattt; sgRNA #2: ctaagtccgatccagtgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous Ste, Pvl. Deletion of 2404 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ Ste, Pvl adults (ve791 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: gaaattcgaaatctacgcaaaatttcagcg ; Right flanking sequence: agggcaaaaaaaaaattgcttaagcctgag. sgRNA #1: accaaatcacgaaaactaga; sgRNA #2: tgaccccaaccagtttctga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.

xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthIs372 [sur-5p::pat-10::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

uthIs202 [aak-2(intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthIs205 [crtc-1p::crtc-1::RFP::unc-54 3'UTR + rol-6(su1006)].

uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

uthEx299 [aak-2 (genomic aa1-aa321)::GFP::unc-54 3'UTR + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.

uthIs225 [sur5p::hsf-1(CT-Delta)::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.

rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]

rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells.

rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age.

rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.

rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.

rmIs290 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.

sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Slow growth.

wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3'UTR + pha-1(+)]. Pan-neuronal expression of nuclear-localized GCaMP6s. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.

wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating wtfIs145. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs263 [rab-3p::AI::ChR2(H134R)::unc-54 3'UTR + rab-3p::AI::Voltron::unc-54 3'UTR + rab-3p::his-24::tagBFP::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of ChR2 (H134R) along with Voltron volatage indicator and nuclear-localized tagBFP. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.