| DV3801 |
C. elegans |
reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DV3825 |
C. elegans |
reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DZ224 |
C. elegans |
him-8(e1489) IV; ezIs1 X. Show Description
ezIs1[K09C8.2::GFP + rol-6(su1006)]. ezIs1 was integrated with pPD95.65(K09C8.2 promoter and unc-54 3') and pRF4. Worms are 100% Rollers. GFP is expressed in male seminal vesicle and vas deferens cells. No expression in the hermaphrodite gonad is observed.
|
|
| DZ325 |
C. elegans |
ezIs2 III; him-8(e1489) IV. Show Description
ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.
|
|
| EAK102 |
C. elegans |
eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EAK103 |
C. elegans |
eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EG2710 |
C. elegans |
unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
|
|
| EG6629 |
C. elegans |
oxIs565 II; oxTi80 III; oxSi199 IV. Show Description
oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
|
|
| EG7212 |
C. elegans |
oxTi330 III; gaIs283. Show Description
oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7213 |
C. elegans |
oxTi331 I; gaIs283. Show Description
oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7214 |
C. elegans |
oxTi333 X; gaIs283. Show Description
oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7215 |
C. elegans |
oxTi334; gaIs283. Show Description
oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7216 |
C. elegans |
oxTi335 X; gaIs283. Show Description
oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7565 |
C. elegans |
unc-119(ed3) III; oxTi392 V. Show Description
oxTi392 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7566 |
C. elegans |
unc-119(ed3) III; oxTi211 V. Show Description
oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7826 |
C. elegans |
unc-119(ed3) III; oxTi308 X. Show Description
oxTi308 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7828 |
C. elegans |
oxTi310 II; unc-119(ed3) III. Show Description
oxTi310 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7831 |
C. elegans |
oxTi648 I; unc-119(ed3) III. Show Description
oxTi648 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7832 |
C. elegans |
oxTi638 I; unc-119(ed3) III. Show Description
oxTi638 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7833 |
C. elegans |
oxTi559 I; unc-119(ed3) III. Show Description
oxTi559 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-4.48. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7835 |
C. elegans |
oxTi556 I; unc-119(ed3) III. Show Description
oxTi556 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.23. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7836 |
C. elegans |
oxTi587 I; unc-119(ed3) III. Show Description
oxTi587 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.28. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7837 |
C. elegans |
oxTi712 I; unc-119(ed3) III. Show Description
oxTi712 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.29. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7838 |
C. elegans |
oxTi718 I; unc-119(ed3) III. Show Description
oxTi718 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.07. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7839 |
C. elegans |
oxTi623 I; unc-119(ed3) III. Show Description
oxTi623 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.75. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7840 |
C. elegans |
oxTi590 I; unc-119(ed3) III. Show Description
oxTi590 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:3.35. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7842 |
C. elegans |
oxTi653 I; unc-119(ed3) III. Show Description
oxTi653 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7843 |
C. elegans |
oxTi398 I; unc-119(ed3) III. Show Description
oxTi398 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:14.26. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7844 |
C. elegans |
oxTi413 I; unc-119(ed3) III. Show Description
oxTi413 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:17.17. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7845 |
C. elegans |
oxTi571 I; unc-119(ed3) III. Show Description
oxTi571 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:21.62. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7846 |
C. elegans |
oxTi700 I; unc-119(ed3) III. Show Description
oxTi700 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:22.30. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7847 |
C. elegans |
oxTi723 I; unc-119(ed3) III. Show Description
oxTi723 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:25.79. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7848 |
C. elegans |
oxTi626 I; unc-119(ed3) III. Show Description
oxTi626 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.18. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7851 |
C. elegans |
oxTi732 I; unc-119(ed3) III. Show Description
oxTi732 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr.I:29.97. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7854 |
C. elegans |
oxTi730 I; unc-119(ed3) III. Show Description
oxTi730 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7855 |
C. elegans |
oxTi724 II; unc-119(ed3) III. Show Description
oxTi724 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7856 |
C. elegans |
oxTi624 II; unc-119(ed3) III. Show Description
oxTi624 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7857 |
C. elegans |
oxTi628 II; unc-119(ed3) III. Show Description
oxTi628 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7858 |
C. elegans |
oxTi729 II; unc-119(ed3) III. Show Description
oxTi729 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7859 |
C. elegans |
oxTi402 II; unc-119(ed3) III. Show Description
oxTi402 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7860 |
C. elegans |
oxTi677 II; unc-119(ed3) III. Show Description
oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-12.17. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7862 |
C. elegans |
oxTi647 II; unc-119(ed3) III. Show Description
oxTi647 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7863 |
C. elegans |
oxTi717 II; unc-119(ed3) III. Show Description
oxTi717 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-4.73. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7864 |
C. elegans |
oxTi726 II; unc-119(ed3) III. Show Description
oxTi726 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at ChrII:-1.02. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7865 |
C. elegans |
oxTi617 II; unc-119(ed3) III. Show Description
oxTi617 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7866 |
C. elegans |
oxTi564 II; unc-119(ed3) III. Show Description
oxTi564 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7867 |
C. elegans |
oxTi394 II; unc-119(ed3) III. Show Description
oxTi394 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7868 |
C. elegans |
oxTi629 II; unc-119(ed3) III. Show Description
oxTi629 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7869 |
C. elegans |
oxTi582 II; unc-119(ed3) III. Show Description
oxTi582 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|
| EG7870 |
C. elegans |
oxTi540 II; unc-119(ed3) III. Show Description
oxTi540 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
|
|