More Fields
Strain Species Genotype
DR119 C. elegans unc-54(e1258) I; dpy-11(e224) wdDp1 V. Show Description
DPY.
DR120 C. elegans unc-54(e1258) I; eDp23 V. Show Description
DR1218 C. elegans mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-265(mn188) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Unc-4 (lethal mid-larval). Maintain by picking WT.
DR176 C. elegans unc-54(e190) I; eDp23 V. Show Description
Suppressed-movement slow. Unlinked double.
DR177 C. elegans unc-54(e1258) I; eDp22 V. Show Description
Suppressed-movement slow.
DR226 C. elegans him-1(e879) unc-54(m36) I. Show Description
Unc. Semi-parlayzed. Segregates males. Heterozygotes are slow moving.
DR286 C. elegans him-8(e1489) IV; unc-58(e665) X. Show Description
Semi-dominant Unc-shaker. Segregates males.
DR290 C. elegans unc-54(m36) I; him-8(e1489) IV. Show Description
Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving.
DR291 C. elegans unc-54(e675) I; eDp23 V. Show Description
Not suppressed. Unc-slow moving.
DR31 C. elegans unc-54(m31) I. Show Description
Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.
DR32 C. elegans unc-54(m32) I. Show Description
Severe Unc. Growth slow. Recessive.
DR33 C. elegans unc-54(m33) I. Show Description
Movement very slow. Recessive.
DR34 C. elegans unc-54(m34) I. Show Description
Moves relatively well. Recessive.
DR36 C. elegans unc-54(m36) I. Show Description
Severe homozygous Unc. Heterozygotes are slow moving. Weakly semi-dominant. Body muscle abnormal.
DR37 C. elegans unc-54(m37) I. Show Description
Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.
DR404 C. elegans unc-54(e1258) I; eDf1 eDp21/+ V. Show Description
DR405 C. elegans unc-54(e190) I; eDf1 eDp21/+ V. Show Description
DR431 C. elegans daf-19(m86)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dauers and DpyUnc.
DR631 C. elegans unc-54(e190) I; sus-1(m156) III. Show Description
Severly paralyzed Unc. More severe than unc-15 alone.
DR722 C. elegans age-1(m333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT phenotype, segregates WT, Egl (age-1 homozygotes) and DpyUncs. Egl animals give all non-recovering dauer larvae (m333 shows maternal effect), with variable radial shrinkage and variable resistance to 1% SDS. Pick WT to maintain and check for correction segregation of progeny. age-1(m333) pka daf-23(m333).
DV3801 C. elegans reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DV3825 C. elegans reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DZ224 C. elegans him-8(e1489) IV; ezIs1 X. Show Description
ezIs1[K09C8.2::GFP + rol-6(su1006)]. ezIs1 was integrated with pPD95.65(K09C8.2 promoter and unc-54 3') and pRF4. Worms are 100% Rollers. GFP is expressed in male seminal vesicle and vas deferens cells. No expression in the hermaphrodite gonad is observed.
DZ325 C. elegans ezIs2 III; him-8(e1489) IV. Show Description
ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.
EAK102 C. elegans eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
EAK103 C. elegans eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
EG2710 C. elegans unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
EG6629 C. elegans oxIs565 II; oxTi80 III; oxSi199 IV. Show Description
oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
EG7212 C. elegans oxTi330 III; gaIs283. Show Description
oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7213 C. elegans oxTi331 I; gaIs283. Show Description
oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7214 C. elegans oxTi333 X; gaIs283. Show Description
oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7215 C. elegans oxTi334; gaIs283. Show Description
oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7216 C. elegans oxTi335 X; gaIs283. Show Description
oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7565 C. elegans unc-119(ed3) III; oxTi392 V. Show Description
oxTi392 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7566 C. elegans unc-119(ed3) III; oxTi211 V. Show Description
oxTi211 [eft-3p::GFP::unc-54 3'UTR + hsp::peel-1 + NeoR + Cbr-unc-119(+)]. Broad, cytoplasmic green fluorescence. pCFJ708 inserted into unc-119(ed3) III (11X outcross) background. Heat-shock inducible negative selection co-inserted (hsp::peel-1). NeoR selection co-inserted. Can be used for positive and negative selection against insertion. Please see www.wormbuilder.org for exact insertion site.
EG7826 C. elegans unc-119(ed3) III; oxTi308 X. Show Description
oxTi308 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7828 C. elegans oxTi310 II; unc-119(ed3) III. Show Description
oxTi310 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7831 C. elegans oxTi648 I; unc-119(ed3) III. Show Description
oxTi648 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7832 C. elegans oxTi638 I; unc-119(ed3) III. Show Description
oxTi638 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7833 C. elegans oxTi559 I; unc-119(ed3) III. Show Description
oxTi559 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:-4.48. Please see www.wormbuilder.org for exact insertion site.
EG7835 C. elegans oxTi556 I; unc-119(ed3) III. Show Description
oxTi556 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.23. Please see www.wormbuilder.org for exact insertion site.
EG7836 C. elegans oxTi587 I; unc-119(ed3) III. Show Description
oxTi587 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.28. Please see www.wormbuilder.org for exact insertion site.
EG7837 C. elegans oxTi712 I; unc-119(ed3) III. Show Description
oxTi712 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:1.29. Please see www.wormbuilder.org for exact insertion site.
EG7838 C. elegans oxTi718 I; unc-119(ed3) III. Show Description
oxTi718 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.07. Please see www.wormbuilder.org for exact insertion site.
EG7839 C. elegans oxTi623 I; unc-119(ed3) III. Show Description
oxTi623 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:2.75. Please see www.wormbuilder.org for exact insertion site.
EG7840 C. elegans oxTi590 I; unc-119(ed3) III. Show Description
oxTi590 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:3.35. Please see www.wormbuilder.org for exact insertion site.
EG7842 C. elegans oxTi653 I; unc-119(ed3) III. Show Description
oxTi653 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7843 C. elegans oxTi398 I; unc-119(ed3) III. Show Description
oxTi398 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:14.26. Please see www.wormbuilder.org for exact insertion site.
EG7844 C. elegans oxTi413 I; unc-119(ed3) III. Show Description
oxTi413 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:17.17. Please see www.wormbuilder.org for exact insertion site.
EG7845 C. elegans oxTi571 I; unc-119(ed3) III. Show Description
oxTi571 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background at Chr. I:21.62. Please see www.wormbuilder.org for exact insertion site.