More Fields
Strain Species Genotype
DA501 C. elegans unc-101(m1) unc-59(e261) I. Show Description
DA620 C. elegans eat-2(ad465) lin-7(e1413) unc-52(e444) II. Show Description
Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc.
DA678 C. elegans unc-57(ad592) dpy-5(e61) I. Show Description
DpyUnc. ad592 is Eat. Dpy is semi-dominant.
DDP1 C. elegans uonEx1. Show Description
uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
DDP2 C. elegans uonEx2. Show Description
uonEx2 [unc-54::CFP::YFP(Venus)]. No additional transformation marker was included in the array. uonEx2 also known as CV in reference publications. Lifespan and pharyngeal pumping rates are similar to N2. This is a high-FRET positive control strain for use in conjunction with DDP1. Because the CFP and YFP protein sequences are covalently fused together (and show little evidence of cleavage), FRET should be high and largely invariant since both fluorescent moieties are always in close proximity. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
DG1255 C. elegans unc-53(e404) sqt-1(e1350) II. Show Description
e1350 is a recessive Dpy, dominant Roller. Unc.
DLW124 C. elegans wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DM1017 C. elegans unc-52(e3003e998) II; ccar-1(ra5) IV. Show Description
Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
DM1151 C. elegans ccar-1(ra20) IV. Show Description
WT in appearance and movement. Some slight muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.
DM1152 C. elegans ccar-1(ra21) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization and gonad disorganization. Slightly reduced brood size. Only suppresses the unc-52(e1421) allele.
DM1153 C. elegans ccar-1(ra14) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
DM1154 C. elegans ccar-1(ra5) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
DM3414 C. elegans unc-4(e120) let-268(ra414)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and lethals.
DM4415 C. elegans unc-52(st196ra515) II. Show Description
WT phenotype. May still carry mut-4(st700).
DM4417 C. elegans mut-4(st700) I; unc-52(st196ra517) II. Show Description
WT movement and body wall muscle.
DM5117 C. elegans unc-52(gk3) II. Show Description
ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DR101 C. elegans dpy-5(e61) unc-55(e1170) I. Show Description
Dpy. Unc. Closely Linked.
DR115 C. elegans unc-15(e73) unc-54(e675) I. Show Description
Slow movement.
DR119 C. elegans unc-54(e1258) I; dpy-11(e224) wdDp1 V. Show Description
DPY.
DR120 C. elegans unc-54(e1258) I; eDp23 V. Show Description
DR1218 C. elegans mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-265(mn188) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Unc-4 (lethal mid-larval). Maintain by picking WT.
DR176 C. elegans unc-54(e190) I; eDp23 V. Show Description
Suppressed-movement slow. Unlinked double.
DR177 C. elegans unc-54(e1258) I; eDp22 V. Show Description
Suppressed-movement slow.
DR226 C. elegans him-1(e879) unc-54(m36) I. Show Description
Unc. Semi-parlayzed. Segregates males. Heterozygotes are slow moving.
DR286 C. elegans him-8(e1489) IV; unc-58(e665) X. Show Description
Semi-dominant Unc-shaker. Segregates males.
DR290 C. elegans unc-54(m36) I; him-8(e1489) IV. Show Description
Severe Unc. Segregates males. M-MATING-NO SUCCESS. Semi-dominant. Heterozygotes are slow moving.
DR291 C. elegans unc-54(e675) I; eDp23 V. Show Description
Not suppressed. Unc-slow moving.
DR31 C. elegans unc-54(m31) I. Show Description
Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.
DR32 C. elegans unc-54(m32) I. Show Description
Severe Unc. Growth slow. Recessive.
DR33 C. elegans unc-54(m33) I. Show Description
Movement very slow. Recessive.
DR34 C. elegans unc-54(m34) I. Show Description
Moves relatively well. Recessive.
DR36 C. elegans unc-54(m36) I. Show Description
Severe homozygous Unc. Heterozygotes are slow moving. Weakly semi-dominant. Body muscle abnormal.
DR37 C. elegans unc-54(m37) I. Show Description
Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.
DR404 C. elegans unc-54(e1258) I; eDf1 eDp21/+ V. Show Description
DR405 C. elegans unc-54(e190) I; eDf1 eDp21/+ V. Show Description
DR431 C. elegans daf-19(m86)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dauers and DpyUnc.
DR631 C. elegans unc-54(e190) I; sus-1(m156) III. Show Description
Severly paralyzed Unc. More severe than unc-15 alone.
DR722 C. elegans age-1(m333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT phenotype, segregates WT, Egl (age-1 homozygotes) and DpyUncs. Egl animals give all non-recovering dauer larvae (m333 shows maternal effect), with variable radial shrinkage and variable resistance to 1% SDS. Pick WT to maintain and check for correction segregation of progeny. age-1(m333) pka daf-23(m333).
DV3801 C. elegans reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DV3825 C. elegans reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DZ224 C. elegans him-8(e1489) IV; ezIs1 X. Show Description
ezIs1[K09C8.2::GFP + rol-6(su1006)]. ezIs1 was integrated with pPD95.65(K09C8.2 promoter and unc-54 3') and pRF4. Worms are 100% Rollers. GFP is expressed in male seminal vesicle and vas deferens cells. No expression in the hermaphrodite gonad is observed.
DZ325 C. elegans ezIs2 III; him-8(e1489) IV. Show Description
ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.
EG2710 C. elegans unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
EG6629 C. elegans oxIs565 II; oxTi80 III; oxSi199 IV. Show Description
oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
EG7212 C. elegans oxTi330 III; gaIs283. Show Description
oxTi330 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7213 C. elegans oxTi331 I; gaIs283. Show Description
oxTi331 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7214 C. elegans oxTi333 X; gaIs283. Show Description
oxTi333 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7215 C. elegans oxTi334; gaIs283. Show Description
oxTi334 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7216 C. elegans oxTi335 X; gaIs283. Show Description
oxTi335 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. gaIs283 [unc-54p::GFP::H2B, myo-3p::GFP::H2B, col-93p::GFP::H2B, ref-1p::GFP::H2B], unmapped. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Crossed to SD1780. unc-119(ed3) may be in background. Please see www.wormbuilder.org for exact insertion site.
EG7565 C. elegans unc-119(ed3) III; oxTi392 V. Show Description
oxTi392 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.