More Fields
Strain Species Genotype
CB2787 C. elegans let-207(e1723) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
CB2842 C. elegans unc-58(e665e2112) X. Show Description
Intragenic revertant of dominant mutation e665. Slight uncoordinated phenotype.
CB3019 C. elegans unc-54(e1258) I; eDf1 eDp21/+ V. Show Description
Movement slow. Suppressed Unc. Revertant. Heterozygotes move slowly and segregate larval lethals (eDf1 eDp21 homozygotes), and paralyzed Uncs.
CB3035 C. elegans unc-54(e1258) I; wdDp1 V. Show Description
Suppressed Unc.
CB306 C. elegans unc-50(e306) III. Show Description
Levamisole resistant. Recessive. Kinky Unc. M-MATING+POOR <1%WT.
CB369 C. elegans unc-51(e369) V. Show Description
Paralyzed Unc. Recessive. M-MATING-NO SUCCESS.
CB3816 C. elegans tra-3(e1107) IV; unc-58(e665) sup-21(e1957) dpy-6(e14)/+ X. Show Description
Heterozygotes are Unc (shaker; don't move well) and segregate more Shaker Unc, WT and DpyUnc (short and fairly paralyzed). The WT give only males. e1957 previously called sup-21.
CB402 C. elegans unc-55(e402) I. Show Description
Unc. Recessive. M-MATING-NO SUCCESS.
CB404 C. elegans unc-53(e404) II. Show Description
Unc-cannot back. Males abnormal. Bursae abnormal. M-MATING-NO SUCCESS.
CB4043 C. elegans smg-2(e2008) I; him-5(e1490) V. Show Description
e2008 recessively suppresses the phenotypes of mutations in unc-54(r293), lin-29(n546), tra-2 and dpy-5. Abnormal male tail. smg-2 homozygotes have slightly abnormal movement.
CB406 C. elegans unc-57(e406) I. Show Description
Unc. Recessive. M-MATING++ 1-10%WT.
CB4077 C. elegans eDf21/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT heterozygotes segregate WT, DpyUnc and unhatched eggs.
CB444 C. elegans unc-52(e444) II. Show Description
Unc. Larvae move. Paralyzed adult. Dystrophic body muscle. M-MATING-NO SUCCESS. Recessive.
CB4567 C. elegans unc-53(e2432) II. Show Description
Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration.
CB4817 C. elegans wDf5(e500)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs.
CB569 C. elegans unc-54(e569) I. Show Description
Paralyzed Unc.
CB576 C. elegans unc-54(e576) I. Show Description
Slow movement.
CB651 C. elegans unc-54(e651) I. Show Description
CB665 C. elegans unc-58(e665) X. Show Description
Shaker Unc. Reverts spontaneously. M-MATING-NO SUCCESS.
CB669 C. elegans unc-52(e669) II. Show Description
Unc-adults paralyzed. Dystrophic body muscle. Suppressed by sup-5 and sup-7. Null allele (?).
CB675 C. elegans unc-54(e675) I. Show Description
Slow moving Unc. Semi-dominant.
CB7080 C. elegans eEx754. Show Description
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB843 C. elegans unc-54(e843) I. Show Description
Stiff. Body muscle abnormal.
CB998 C. elegans unc-52(e998) II. Show Description
Severe Unc. Paralyzed adults. Dystrophic body muscle.
CD184 C. elegans ace-3(dc2) unc-52(e444) II. Show Description
Acetylcholine abnormal. Unc (phenotype exactly like unc-52 except lacking class C acetylcholinesterase).
CD194 C. elegans lin-7(e1413) unc-52(e444) II. Show Description
Unc and Vul.
CD196 C. elegans ace-3(dc2) unc-52(e444) egl-50(n1086) II. Show Description
Unc and Egl.
CF4582 C. elegans muIs252 II; unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of wrmScarlet1-10 (under the control of the eft-3 promoter and unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4587 C. elegans muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4588 C. elegans muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4610 C. elegans muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CGC105 C. elegans hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
CGC43 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
CGC48 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 C.elegans gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC61 C. elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 C. elegans npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC78 C. elegans C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC94 C. elegans hIn1 [umnIs75] I. Show Description
umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::GFP transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
CL2006 C. elegans dvIs2. Show Description
dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.
CL2008 C. elegans him-5 (e1490) V; dvIs3. Show Description
dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.
CL2120 C. elegans dvIs14. Show Description
dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.
CL2122 C. elegans dvIs15. Show Description
dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Control strain for CL2120. Phenotype apparently WT.
CY251 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY262 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY401 C. elegans sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.
CZ3086 C. elegans kin-1(ok338)/unc-54(r293) I. Show Description
Heterozygotes are WT and segregate WT, Unc, and early larval lethal.