Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult) and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult-> Lays unfertilized eggs) and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet (Sterile adult; Vulva protrudes; partial rescue at 15C) and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval (hatches). Maintain by picking WT.

Heterozygotes are WT and segregate WT, dead eggs, no Unc-36, and DpyUncLet. Lethal early larva. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

Throws Unc-36 and WT. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.

Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.

eDf43 pka lin-49(e2173). Heterozygotes are WT and segregate WT, Unc-36, and LinDpys. The lin-40 dpy-11 homozygotes are Dpy, Sterile and abnormal. Maintain by picking WT.

M-MATING+POOR <1%WT. Recessive. Poor movement forward and backward. Unc-36 phenotype. Dead eggs.

umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.

Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.

Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.

Heterozygotes are WT and segregate WT, Unc-32 maternal effect lethals (Mel) and Unc-36.

Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).

Heterozygotes are WT and segregate WT, Unc-46 Steriles, and Unc-36 (eT1 homozygotes). Maintain by picking WT.

Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs. dpy-19 ego-4 progeny die as embryos.

Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.

Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.

Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.

Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.

Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36, dead eggs and zygotic embryonic lethals (nDf40 dpy-18 homozygotes). Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, and Sqvs which have an abnormal vulva from mid-L4 and are sterile.

Heterozygotes are WT and segregate WT, DpySqv, Unc-36 and dead eggs.

Heterozygotes are WT and segregate WT, Sqv, Unc-36 and dead eggs.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. ZK858.7. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

mnIs35 [smu-2::GFP + unc-36(+)]. Superficially wild-type. Although unlikely, unc-36 might still be present in the background. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

maIs103[rnr::GFP unc-36(+)]. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

maIs103[rnr::GFP unc-36(+)] X. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.

Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.

WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.