JJ1238 |
C. elegans |
unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
|
|
JJ1244 |
C. elegans |
mex-6(pk440) II; unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
|
|
JJ1833 |
C. elegans |
dpy-5(e61) I; unc-32(e189) III. Show Description
Dpy Unc.
|
|
JJ1972 |
C. elegans |
eel-1(zu462) unc-33(e204) IV. Show Description
Slow growth and a maternal-effect enhancer of the efl-1(se1) embyronic lethal phenotype. Unc.
|
|
JK1122 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and DpySteriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1129 |
C. elegans |
unc-32(e189) qDf2/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1195 |
C. elegans |
lin-12(q269) glp-1(q231)/unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Lags (ts). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1219 |
C. elegans |
unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1389 |
C. elegans |
mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1505 |
C. elegans |
unc-32(e189) glp-1(e2072) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK1774 |
C. elegans |
eef-1A.1(q145)/sma-3(e491) unc-36(e251) III. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects. eft-3(q145) previously called glp-3(q145).
|
|
JK590 |
C. elegans |
glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
|
|
JK633 |
C. elegans |
unc-36(e873)/unc-32(e189) glp-1(q46) III. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and UncSteriles and dead eggs. e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK867 |
C. elegans |
dpy-17(e164) ncl-1(e1865) unc-36(e251) III; qDp3 (III;f). Show Description
Animals which have the Duplication are Dpy. Animals which have lost the Duplication are DpyUncNcl. qDp3 homozygotes are lethal. Maintain by picking Dpy non-Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK892 |
C. elegans |
unc-36(e873)/unc-32(e189) glp-1(q231) III. Show Description
Heterozygotes are WT. At 25C hets segregate WT, Unc-36 and UncSterile and dead eggs. At 15C, hets segregate WT, Unc-36, dead eggs and Unc-32 (which are fertile and can be maintained as homozygous stock). e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK948 |
C. elegans |
unc-32(e189) glp-1(q231) III; sog-4(q304) V. Show Description
Unc. sog-4 suppresses glp-1 at or below 20C. Do not maintain above 20C. Some Glp dead embryos because suppression is incomplete. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK966 |
C. elegans |
unc-32(e189) glp-1(q224) III; sog-5(q297) X. Show Description
Unc. sog-5 suppresses glp-1 at or below 20C. Stock cannot be maintain above 20C. Some dead Glp embryos on plates. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK967 |
C. elegans |
ubr-5(q298) I; unc-32(e189) glp-1(q231) III. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK968 |
C. elegans |
unc-32(e189) glp-1(q231) III; sog-6(q306) IV. Show Description
Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-6. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JS71 |
C. elegans |
dpy-11(e224) air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.
|
|
JS83 |
C. elegans |
air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
|
|
KG115 |
C. elegans |
lin-1(e1275) unc-33(e204)/ric-8(ok98) IV. Show Description
ok98/+ animals are slightly Egl-d and have a small vulval bump. ok98 homozygotes are straight and paralyzed and slow growing. About 2/3 eventually reach adulthood and are paralyzed and sterile (they produce few if any oocytes). Segregates Unc Muv(ts).
|
|
KG1180 |
C. elegans |
lite-1(ce314) X. Show Description
Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.
|
|
KK204 |
C. elegans |
sma-4(e729) mab-5(e1239) unc-36(e251) III. Show Description
Small and Unc.
|
|
KR1406 |
C. elegans |
unc-37(h763) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
|
|
KR2467 |
C. elegans |
dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, lethal hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Maintain by picking WT. [March 1995: Apparently the lethal mutation is not in the balanced region. It occasionally crosses off and the strain starts giving Bli-4 hT2 homozygotes again. From Mark Edgley.] This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|
LB128 |
C. elegans |
atp-2(ua2) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.
|
|
LE983 |
C. elegans |
unc-34(lq17) V. Show Description
|
|
MH37 |
C. elegans |
mpk-1(ku1) unc-32(e189) III. Show Description
Unc. ku1 pka sur-1(ku1).
|
|
ML1214 |
C. elegans |
pros-1(mc41)/dpy-17(e164) unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, Dpy Uncs, and dead L2 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn). [NOTE: mc41 was initially described as an allele in rdy-3, but the affected gene has since been identified as pros-1]
|
|
MLC530 |
C. elegans |
lucSi30 II; henn-1(tm4477) III. Show Description
lucSi30 [unc-31p::HEN1::unc-54 3Â’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
|
|
MS231 |
C. elegans |
dpy-17(e164) ncl-1(e1865) unc-36(e251) III; irDp1 (III;f). Show Description
Superficially WT. Pick WT to propagate. Throws WT (expressing unc-119::YFP) and DpyUncs. irDp1 is sDp3 carrying a spontaneous integrant of an array carrying unc-119::YFP + unc-32(+) + med-1(+), originally generated in BC4638. irDp1 appears to complement everything sDp3 does and has a similar meiotic transmission frequency of 60%. In another strain, irDp2 was observed to lose ability to complement dpy-17. irDp1 confers a progressive adult egg laying defect (also seen with sDp3).
|
|
MT10784 |
C. elegans |
dpy-18(e364) lis-1(n3334) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.
|
|
MT1207 |
C. elegans |
unc-31(n577) IV. Show Description
Temperature sensitive. pka egl-22.
|
|
MT1373 |
C. elegans |
lin-13(n387)/unc-32(e189) III; him-5(e1467) V. Show Description
Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, Sterile Muv, and males. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. The male phenotype similarly is heat sensitive; only males that are the progeny of lin-13 hermaphrodites and are grown at 20C or 25C have ventral protrusions. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.
|
|
MT1422 |
C. elegans |
paqr-2(n573) unc-32(e189) III. Show Description
Egl. Unc.
|
|
MT15537 |
C. elegans |
unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. Show Description
Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
|
|
MT1784 |
C. elegans |
dpy-20(e1362) unc-31(e169) IV. Show Description
Dpy. Unc.
|
|
MT1799 |
C. elegans |
lin-36(n766) unc-32(e189) III. Show Description
Unc.
|
|
MT1908 |
C. elegans |
nDf21/dpy-19(e1259) unc-32(e189) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUncs and dead eggs.
|
|
MT1909 |
C. elegans |
nDf22/dpy-19(e1259) unc-32(e189) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs. e1259 has a ts maternal effect.
|
|
MT1965 |
C. elegans |
lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. Show Description
Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.
|
|
MT1978 |
C. elegans |
nDf16/unc-36(e251) dpy-19(e1259) III. Show Description
Heterozygotes are Unc and segregate Unc, DpyUnc (Dpy is ts) and dead eggs. Maintain by picking Uncs.
|
|
MT20108 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT. Segregates Dpy Sterile and Dpy Unc.
|
|
MT20109 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1. Fails to complement all markers on qC1. Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc.
|
|
MT20113 |
C. elegans |
unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
|
|
MT2343 |
C. elegans |
dpy-19(e1259) lin-12(n137)/unc-32(e189) lin-12(n137n720) III. Show Description
Heterozygotes are Muv and Egl (n137 is semi-dominant) and segregate DpyMuv and Unc lethals (most arrest as L1-L3, the few survivors are sterile, scrawny, Unc and have a large ventral blip at hte position of the vulva). Maintain by picking non-Dpy non-Unc.
|
|
MT2351 |
C. elegans |
lin-10(e1439) I; dpy-19(e1259) lin-12(n137)/unc-32(e189) lin-12(n137n720) III. Show Description
Heterozygotes are Muv. Segregates DpyMuv and Unc.
|
|
MT2583 |
C. elegans |
dpy-11(e224) nDf32 V/eT1 (III;V). Show Description
Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
|
|