VC2452 |
C. elegans |
unc-22(gk2608gk2609) IV. Show Description
Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2608gk2609), it is homozygous for 224 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
VC30130 |
C. elegans |
Show Description
Million Mutation Project strain. This strain was isolated after ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Note that this strain is known to segregate homozygous unc-22 and strong Dumpy progeny (gene not identified). The strain was validated by PCR and sequencing of the allele gk421264 in D2030.11. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
|
|
VC3083 |
C. elegans |
unc-22(gk3076) IV. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4382 |
C. elegans |
ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
WH171 |
C. elegans |
eff-1(oj55) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
|
|
WM101 |
C. elegans |
unc-24(e138) oma-1(ne411) IV; lon-2(e678) X. Show Description
Lon. Maintain at 15C. Produces dead eggs at 25C.
|
|
WU144 |
C. elegans |
lin-45(n1924) unc-24(e138) IV. Show Description
Weak lin-45 raf allele: 5% larval lethal. Otherwise, essentially WT vulval induction and fertility. n1924 effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
|
|
WU49 |
C. elegans |
lin-45(n2506) unc-24(e138) IV. Show Description
Intermediate strength lin-45 raf allele: 86% larval lethal, 93% of adults display an abnormal vulva (either Egl, no discernable vulva, or PVul), and 3% of adults are Sterile. Unc.
|
|
WU51 |
C. elegans |
lin-45(n2520) unc-24(e138) IV. Show Description
Weak severity of lin-45 raf allele: WT viability, vulval induction and fertility but effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
|
|
WU53 |
C. elegans |
lin-45(n1925) unc-24(e138) IV. Show Description
Weak lin-45 raf allele: essentially WT viability, vulval induction and fertility but effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
|
|
WU57 |
C. elegans |
lin-45(n2510) unc-24(e138)/unc-5(e53) dpy-20(e1282) IV. Show Description
Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.
|
|
XE1158 |
C. elegans |
juIs76 II; wpIs15 X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. wpIs15 [unc-47p::KillerRed] X. Slight Unc. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpIs15 produces a Shrinker phenotype after illumination by white light for 2 hrs. Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.
|
|
XM1002 |
C. elegans |
vab-1(dx31) III; itr-1(sy290) unc-24(e138) IV. Show Description
vab-1 null and itr-1 gain of function. Viable. Unc.
|
|
ZM10176 |
C. elegans |
unc-25(e156) III; hpIs593; ljIs131. Show Description
hpIs593 [ttr-39p::Chrimson::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. D motor neurons are marked with red fluorescence. No behavioral change upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM10311 |
C. elegans |
unc-25(e156) III; ljIs131; hpIs758. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpIs758 [rig-3p::LoxP::eBFP::LoxP::Chrimson::wCherry + twk-40(s)p::Cre + myo-2p::wCherry]. Pick animals with red fluorescence to maintain. Shrinker. RFP expression in AVA and a few other neurons. Reversal upon green light illumination with ATR. hpIs758 is a spontaneous insertion of hpEx4080. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM10484 |
C. elegans |
unc-25(e156) III; hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM10823 |
C. elegans |
hpIs596; hpIs268. Show Description
hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
|
|
ZM1157 |
C. elegans |
daf-2(e1370) III; juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
|
|
ZM1344 |
C. elegans |
hpIs61 II. Show Description
hpIs61 [unc-25p::unc-10::GFP]. hpIs61 maps to LG II.
|
|
ZM2246 |
C. elegans |
hpIs88. Show Description
hpIs88 [unc-25p::mCherry::unc-10 + lin-15(+)]. mCherry is fused to the N-terminus of UNC-10. Weak RFP expression in nerve ring, small and round RFP puncta on both ventral and dorsal nerve cord. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.
|
|
ZM54 |
C. elegans |
hpIs3 X. Show Description
hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
|
|
ZM588 |
C. elegans |
fsn-1(hp1) III; juIs1 IV; scd-2(ok565) V. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Animals are WT looking. In WT, GABAergic synapses visualized with juIs1 (GABAergic nervous system specific synaptobrevin::GFP) marker show uniformly spaced and sized puncta. fsn-1(hp1); scd-2(ok565) animals have puncta close to WT shape. This is more evident in larvae than in adults.
|
|
ZM6665 |
C. elegans |
hpIs268. Show Description
hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Strain allows calcium imaging for D-motor neurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
|
|
ZM7648 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3195. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3195 [unc-25p::ATG::nca-1 + nca-1::GFP + odr-1p::GFP]. Pick animals with GFP in GABAergic neurons to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
ZM7656 |
C. elegans |
hpIs365. Show Description
hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM7696 |
C. elegans |
hpIs376. Show Description
hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
|
|
ZM8614 |
C. elegans |
hpIs372; hpIs365. Show Description
hpIs372 [acr-5p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM8615 |
C. elegans |
hpIs371; hpIs365. Show Description
hpIs371 [unc-4p::miniSOG::SL2::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9172 |
C. elegans |
unc-25(e156) III; ljIs131. Show Description
ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9573 |
C. elegans |
unc-25(e156) III; zxIs6; ljIs131. Show Description
zxIs6 [unc-17p::ChR2::YFP + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Cholinergic activation. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9585 |
C. elegans |
hpIs615; hpIs365. Show Description
hpIs615 [acr-2(s)p::Arch::wCherry + lin-15(+)]. hpIs365 [unc-25p::GCaMP3::wCherry + lin-15(+)]. RFP expression in motor neurons. A and B motor neurons are inhibited and body relaxes upon illumination with green light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM9660 |
C. elegans |
unc-25(e156) III; hpIs673; ljIs131. Show Description
hpIs673 [rgef-1p::Chrimson::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. All neurons are marked with red fluorescence. Pan-neuronal activation and muscle contraction upon green light illumination with ATR. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZZ30 |
C. elegans |
unc-29(x30) I. Show Description
Recessive. Levamisole resistant. WT movement. Weakly to moderately temperature sensitive.
|
|
ZZ545 |
C. elegans |
unc-29(x545) I. Show Description
|
|