Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
LE3192 C. elegans tiam-1(ok772) I; juIs76 II; mig-2(mu28) lqIs2 X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3193 C. elegans tiam-1(ok772) I; juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE4325 C elegans lqIs294. Show Description
lqIs294 [unc-25p::myr::unc-5 + gcy-32p::YFP]. VD/DD axon guidance defects. YFP expression in AQR, PQR and URXL/R. Reference: Norris AD, et al. Development. 2014 Nov;141(22):4395-405. doi: 10.1242/dev.110437. PMID: 25371370.
LE479 C. elegans juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. Cell engulfment defect at 2-fold stage. Reference: Demarco RS & Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.
LE6273 C. elegans src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
LE6655 C elegans tom-1(lq176) I; juIs76 II; lqIs345. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs345 [egl-17p::mCherry + gcy-32p::CFP + scm::GFP]. VD/DD axon guidance defects. lq176 is a short isoform-specific allele of tom-1. Reference: Mahadik SS & Lundquist EA. Development 2023 Apr 1;150(7):dev201031. Doi: 10.1242/dev.201031. PMID: 37014062
LE6897 C. elegans src-1(syb7248)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.
LX658 C. elegans mnDp33 (X;IV)/+ IV; unc-20(e112) rgs-7(vs92) X. Show Description
Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.
MH2211 C. elegans unc-29(e1072); sur-6(ku123); kuIs57. Show Description
kuIs57 [col-10p::lin-45(gf) + sur-5::GFP]. Reference: Yoder JH, et al. EMBO J. 2004 Jan 14;23(1):111-9.
ML456 C. elegans ale-1(mc14)/spe-6(hc49) unc-25(e156) III. Show Description
Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.
ML732 C. elegans vha-5(mc38)/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
MT12024 C. elegans unc-24(e138) dpy-20(e1282) IV. Show Description
Dpy (ts). Unc (amber).
MT15080 C. elegans sup-17(n1306) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15081 C. elegans sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15082 C. elegans sup-17(n1318) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15083 C. elegans sup-17(n1319) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15084 C. elegans sup-17(n1320) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT2003 C. elegans lin-28(n719) unc-29(e403) I. Show Description
Egl. Unc.
MT2405 C. elegans ced-3(n717) unc-26(e205) IV. Show Description
Unc. Abnormal cell death. Cells that normally die survive.
MT2941 C. elegans sup-17(n1305) unc-29(e1072) I. Show Description
ts. Dpy. Egl. sup of lin-12(d).
MT2956 C. elegans dpy-14(e188) unc-29(e1072) I. Show Description
ts Dpy. e1072am.
MT2966 C. elegans sup-17(n1313) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT2967 C. elegans sup-17(n1314) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT2969 C. elegans sup-17(n1316) unc-29(e1072)/dpy-14(e188) I. Show Description
Heterozygotes are WT and segregate WT, Dpys and very slow growing Uncs. Maintain by picking WT.
MT2970 C. elegans sup-17(n1317) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT3191 C. elegans unc-29(x520) I. Show Description
MT3192 C. elegans unc-29(x522) I. Show Description
MT3193 C. elegans unc-29(x544) I. Show Description
MT3198 C. elegans unc-13(e1091) unc-29(e1072) I. Show Description
MT3414 C. elegans dpy-20(e1282) unc-31(e169) unc-26(e205) IV. Show Description
Dpy Unc.
MT3632 C. elegans lin-10(n1511) unc-29(e1072) I. Show Description
Vul. Unc-Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active.
MT4244 C. elegans unc-24(e138) let-60(n1046) IV. Show Description
Unc. Muv (sd, gf).
MT4574 C. elegans let-60(n1531)/let-60(n1046) unc-22(e66) IV. Show Description
Heterozygotes are WT and segregate WT, MuvUnc (n1046 e66) and n1531 homozygotes whose phenotypes range from a few dead larva to sterile adults. The normal larval lethality of n1531/n1531 is suppressed by the maternal contribution of n1046. n1046 is semi-dominant.
MT458 C. elegans unc-20(e112) lon-2(e678) X. Show Description
Lon. Unc-ts.
MT4629 C. elegans mars-1(s254) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.
MT4684 C. elegans lin-3(n1059) dpy-20(e1362)/unc-24(e138) mec-3(e1338) dpy-20(e1282) IV. Show Description
Heterozygotes are Dpy and segregate Dpy, Dpy Lethals (early larval) and DpyUncMec.
MT4700 C. elegans let-60(n1531) unc-22(e66)/let-60(n1700) dpy-20(e1282) IV; him-5(e1490) V. Show Description
Heterozygotes are mostly non-Muv (about 20% will be Muv because n1700 is semi-dominant) and non-Unc. Hets segregate Twitchers which die at various larval stages or as Vul adults, because of the maternal effect rescue of n1531 by n1700. The Twitchers will not give viable progeny. Hets also segregate DpyMuvs. The strain segregates males which will mate, though not very well.
MT4828 C. elegans let-60(n2031)/dpy-20(e1362) unc-22(e66) IV. Show Description
n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).
MT5499 C. elegans let-60(n1876) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.
MT5726 C. elegans dpy-20(e1362) unc-22(e66) IV; him-5(e1490) V; nDp5 (IV;f). Show Description
Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Twitchers. Throws both WT and DpyTwitcher males. Maintain by picking WT.
MT6184 C. elegans unc-52(e444) II; unc-25(e156) dnj-17(ju1162) III; dpy-4(e1166) IV. Show Description
MT6214 C. elegans unc-25(n2379) III. Show Description
Con, Shk(ts). Weak allele of unc-25.
MT6490 C. elegans unc-25(n2569) III. Show Description
Temperature sensitive. At 25C, constitutive shrinker. At 20C, non-shrinker constitutive weak.
MT7052 C. elegans lin-45(sy96) unc-24(e138) IV. Show Description
MT7620 C. elegans lin-45(n2506) unc-24(e138)/bli-6(sc16) unc-24(e138) IV. Show Description
Heterozygotes are Unc and segregate Unc, UncVul, and BliUnc.
MT7897 C. elegans lin-41(n2914)/unc-29(e1072) lin-11(n1281) I. Show Description
Heterozygotes are WT and segregate WT, UncVul and lin-41 (Dpy, Scrawny and Sterile).
MT8998 C. elegans unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.
MT9647 C. elegans unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.
NL3643 C. elegans unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
NW1615 C. elegans plx-1(ev724) jcIs1 IV; him-5(e1490) V. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.