juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. Cell engulfment defect at 2-fold stage. Reference: Demarco RS & Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs345 [egl-17p::mCherry + gcy-32p::CFP + scm::GFP]. VD/DD axon guidance defects. lq176 is a short isoform-specific allele of tom-1. Reference: Mahadik SS & Lundquist EA. Development 2023 Apr 1;150(7):dev201031. Doi: 10.1242/dev.201031. PMID: 37014062

juIs76 [unc-25p::GFP + lin-15(+)] II. D381A substitution mutation generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), embryonic lethality (syb7248 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https://doi.org/10.1101/2023.05.20.541322.

Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.

kuIs57 [col-10p::lin-45(gf) + sur-5::GFP]. Reference: Yoder JH, et al. EMBO J. 2004 Jan 14;23(1):111-9.

Heterozygotes are WT and segregate WT, embryonic lethals (embryos fail to elongate) and Sterile Uncs. mc14 identified as a mutation that leads to abnormal lin-26 expression.

Heterozygotes are WT and segregate WT, DpyUncs, and dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).

Dpy (ts). Unc (amber).

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Egl. Unc.

Unc. Abnormal cell death. Cells that normally die survive.

ts. Dpy. Egl. sup of lin-12(d).

ts Dpy. e1072am.

Suppressor of lin-12(d).

Suppressor of lin-12(d).

Heterozygotes are WT and segregate WT, Dpys and very slow growing Uncs. Maintain by picking WT.

Suppressor of lin-12(d).

Dpy Unc.

Vul. Unc-Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active.

Unc. Muv (sd, gf).

Heterozygotes are WT and segregate WT, MuvUnc (n1046 e66) and n1531 homozygotes whose phenotypes range from a few dead larva to sterile adults. The normal larval lethality of n1531/n1531 is suppressed by the maternal contribution of n1046. n1046 is semi-dominant.

Lon. Unc-ts.

Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.

Heterozygotes are Dpy and segregate Dpy, Dpy Lethals (early larval) and DpyUncMec.

Heterozygotes are mostly non-Muv (about 20% will be Muv because n1700 is semi-dominant) and non-Unc. Hets segregate Twitchers which die at various larval stages or as Vul adults, because of the maternal effect rescue of n1531 by n1700. The Twitchers will not give viable progeny. Hets also segregate DpyMuvs. The strain segregates males which will mate, though not very well.

n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).

Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.

Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Twitchers. Throws both WT and DpyTwitcher males. Maintain by picking WT.

Con, Shk(ts). Weak allele of unc-25.

Temperature sensitive. At 25C, constitutive shrinker. At 20C, non-shrinker constitutive weak.

Heterozygotes are Unc and segregate Unc, UncVul, and BliUnc.

Heterozygotes are WT and segregate WT, UncVul and lin-41 (Dpy, Scrawny and Sterile).

Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.

Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.

Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-2(ev709). Vulva cell migration defects. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Strain does not Roll but otherwise seems fine. Male ray 1 anterior displacement in homozygous animals. Genetic interaction with smp-1(ev715). ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.