wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are slow-growing DpyUnc with cell fusion problems and pharyngeal GFP signal. Segregates arrested hT2 aneuploids, and non-GFP DpyUnc gk324 homozygotes (Sterile, Dpy and Unc). All worms express ajm-1::GFP(Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.

ggIs28 [nrde-3p::3xFlag::GFP::nrde-2 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. nhr-57p::GFP is expressed at low levels. Superficially wild-type. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. ia61 was induced by Mos1 mutagenesis. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs7 contains [nhr-57p::GFP + unc-119(+)]. Egl. Published in Shao, Zhang, and Powell-Coffman Genetics (2009).

iaIs34 contains [hif-1p::hif-1a (P621G)::tag + unc-119(+)]. Published in Zhang et al PLoS ONE 4: e6348 (2009).

iaIs21 [gcy-35p::GFP + unc-119(+)]. gcy-35::GFP is expressed in fifteen neurons, all of which also express ahr-1: AQR, PQR, URXR/L, ALNL/R, BDUL/R, SDQL/R, PLML/R, AVM, and two neurons in the tail tentatively identified as PLNL/R. gcy-35::GFP is only transiently expressed in PLML/R during the first larval stage.

iaIs25 [gcy-37p::GFP + unc-119(+)]. gcy-37::GFP is consistently expressed in AQR, PQR, URXL. and URXR neurons. Expression also observed in AVM and two unidentified neurons located in the head.

iaIs19 [gcy-32p::GFP + unc-119(+)]. Expression of gcy-32::GFP is consistenly observed in AQR, PQR, and URX neurons.

iaIs22 [gcy-36p::GFP + unc-119(+)]. gcy-36::GFP is consistently expressed in AQR, PQR, URXL and URXR neurons.

fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] V. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)]. Reference: Zhao Z, et al. https://doi.org/10.21203/rs.3.rs-4664717/v1

sosIs3 [unc-119p::ddi-1::GFP]. ddi-1 also known as vsm-1.

byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.

muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Dpy, Unc. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (BC277 x N2 Male) x TU3401. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (unc-46(e177) uIs69) x N2 Male. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

lstEx112 [unc-119p::pdfr-1a::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1a isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx117 [unc-119p::pdfr-1b::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1b isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

lstEx122 [unc-119p::pdfr-1c::3'UTR + elt-2p::GFP]. Pick GFP+ animals to maintain. Neuron-specific expression of pdfr-1c isoform rescues pdfr-1 locomotion defects; wild-type locomotion. Reference: Meelkop E, et al. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):232-40.

sqIs71 [rgef-1p::GFP + rgef-1p::sid-1]. Pan-neuronal expression of sid-1 driven by the rgef-1 promoter. Expression remains neuron-specific until at least Day 10. Animals respond to feeding RNAi against gfp and neuronal genes snb-1 and unc-13. In contrast, animals are resistant to phenotypes induced by feeding RNAi constructs targeting non-neuronal genes pept-1, unc-112, bli-1 and die-1. Reference: Yang Y, et al. Nat Aging 2024 Jan 4. doi: 10.1038/s43587-023-00548-1. PMID: 38177330. MAH677 effectively replaces strain TU3401 sid-1(pk3321) uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1] V., which was found to show RNAi response in non-neuronal tissues.

uIs59 [unc-119p::YFP]. Pan-neuronal YFP expression. Maintain 15-20C. Reference: Calixto A, et al. (2010) Nature Methods 7:554-9.

uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]; appears to map to LG V. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees; sick at 25 C. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs72 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1 + mec-18p::mec-18::GFP]. Hypersensitive neuronal RNAi by feeding. GFP detectable in TRNs. Him (~50% males). Maintain 15-20 degrees. Reference: Chalfie (2010) Worm Breeders Gazette.

qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.