More Fields
Strain Species Genotype
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
DE112 C. elegans sup-46(qa710) I; dnSi4 II; unc-119(ed9) III. Show Description
dnSi4 [gna-1::GFP::gna-1 3’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Unknown if unc-119(ed9) III is homozygous or heterozygous in this strain.
DE115 C. elegans dnSi8 I; unc-119(ed3) III; dnIs22. Show Description
dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]
DE116 C. elegans dnSi9II; unc-119(ed9) III. Show Description
dnSi9 [sup-46::GFP::sup-46 3’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Strong nuclear-localized GFP expression (expression from dnIs22 is brighter).
DE130 C. elegans unc-119(e2488) III; dnIs24. Show Description
dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.
DE90 C. elegans oxIs318 II; unc-119(ed3 or e2498) ruIs32 III; ddIs6 V; dnIs17. Show Description
oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.
DG2102 C. elegans unc-119(ed3) III; tnIs13 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)].
DG2160 C. elegans tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
DG2189 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
DG2190 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
DG3485 C. elegans sacy-1(tm5503) I; tnEx159. Show Description
tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics
DG3929 C. elegans tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Show Description
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.
DLM1 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx1. Show Description
uwaEx1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM10 C. elegans uwaSi5 II; unc-119(ed3) III. Show Description
uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM11 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx6. Show Description
uwaEx6 [rab-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in neurons. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM12 C. elegans uwaSi6 II; unc-119(ed3) III. Show Description
uwaSi6 [rab-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in neurons. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM13 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx7. Show Description
uwaEx8 [eft-3p::CERULEAN-VENUS + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM14 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx8. Show Description
uwaEx8 [eft-3p::CERULEAN-VENUS::tomm-7 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed tomm-7 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM2 C. elegans uwaSi1 II; unc-119(ed3) III. Show Description
uwaSi1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM21 C. elegans unc-119(ed3)III; uwaEx4. Show Description
uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).
DLM3 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx2. Show Description
uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM4 C. elegans uwaSi2 II; unc-119(ed3) III. Show Description
uwaSi2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM5 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx3. Show Description
uwaEx3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM6 C. elegans uwaSi3 II; unc-119(ed3) III. Show Description
uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM7 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx4. Show Description
uwaEx4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM8 C. elegans uwaSi4 II; unc-119(ed3) III. Show Description
uwaSi4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLM9 C. elegans ttTi5605 II; unc-119(ed3) III; uwaEx5. Show Description
uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DLW14 C. elegans unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
DM1208 C. elegans unc-112(r367ra202) V. Show Description
Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.
DM1245 C. elegans unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. Show Description
Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
DM3004 C. elegans unc-112(r367) V; raDf4/+ X. Show Description
The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.
DM3006 C. elegans unc-112(r367) V; raDf6/+ X. Show Description
The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.
DM3007 C. elegans unc-112(r367) V; +/raDf7 X. Show Description
raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.
DM3009 C. elegans unc-112(r367) V; raDf9/+ X. Show Description
The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.
DM3010 C. elegans unc-112(r367) V; raDf10/+ X. Show Description
The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
DM3011 C. elegans unc-112(r367) V; raDf11/+ X. Show Description
The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.
DM3012 C. elegans unc-112(r367) V; raDf12/+ X. Show Description
The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.
DM5113 C. elegans unc-112(r367) V; raEx11. Show Description
raEx11 [(pDM#208) unc-112(+) + rol-6(su1006)]. Maintain by picking Rollers. raEx11 rescues the r367 phenotype. Segregates Unc-112 and Rollers.
DM5115 C. elegans unc-112(st581) V; raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
DM5116 C. elegans unc-112(gk1)/unc-39(e257) V. Show Description
C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DM7016 C. elegans raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
DM8008 C. elegans raIs8. Show Description
raIs8 [unc-112::GFP + rol-6(su1006)]. Rollers. raIs8 produces a fully functional GFP-tagged UNC-112 protein that localizes to the dense bodies and M-line in muscle cells. Derived by integrating raEx16 in DM7016.
DP132 C. elegans edIs6 IV. Show Description
edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.
DP38 C. elegans unc-119(ed3) III; daf-?. Show Description
Unc. Contains an unlinked dauer constitutive mutation. See HT1593 for a stock with the Daf mutation removed.
DY164 C. elegans unc-32(e189) syIs80 III; him-8(e1489) IV. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.
DZ325 C. elegans ezIs2 III; him-8(e1489) IV. Show Description
ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.
DZ390 C. elegans ezIs10 II; unc-119(ed3) III; him-8(e1489) IV. Show Description
ezIs10 [(pWY3) lin-32::GFP + unc-119(+)].
DZ710 C. elegans fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
EG4322 C. elegans ttTi5605 II; unc-119(ed9) III. Show Description
Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]