wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx551 [cima-1p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx551 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx644 [ttx-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx642 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx647 [hlh-17p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx647 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx765 [dpy-7p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx765 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx775 [dpy-4p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP1-10 + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP1-10 + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP1-10 and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

olaIs35 [ttx-3Gp::eGFP::lgg-1 + ttx-3Gp::mCherry + unc-122p::RFP]. Integrated transgene allows visualization of autophagosomes in a single neuron (AIY). "ttx-3G" refers to genomic fragment containing AIY motif described in Bertrand & Hobert Dev Cell. 2009 Apr;16(4):563-75. References: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85. Hill SE, et al. Dev Cell. 2019 Mar 8. pii: S1534-5807(19)30104-2.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. AIY presynaptic maintenance defect at adult stage (synapses appears in asynaptic Zone 3 region). Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx559 [rol-6p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx559 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

dnSi4 [gna-1::GFP::gna-1 3’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Unknown if unc-119(ed9) III is homozygous or heterozygous in this strain.

dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]

dnSi9 [sup-46::GFP::sup-46 3’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Strong nuclear-localized GFP expression (expression from dnIs22 is brighter).

dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.

oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)].

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.

tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics

tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.

uwaEx1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx6 [rab-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in neurons. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS::tomm-7 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed tomm-7 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).

otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.