VT1492 |
C. elegans |
unc-119(ed3) III; maIs196. Show Description
maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.
|
|
VT1494 |
C. elegans |
unc-119(ed3) III; maIs197. Show Description
maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.
|
|
VT1503 |
C. elegans |
unc-119(ed3) III; maIs206. Show Description
maIs206 [mir-81p::GFP + unc-119(+)]. Wild type.
|
|
VT1539 |
C. elegans |
unc-119(ed3) III; maIs218. Show Description
maIs218 [mir-231p::GFP + unc-119(+)]. Wild type.
|
|
VT1541 |
C. elegans |
unc-119(ed3) III; maIs220. Show Description
maIs220 [mir-360p::GFP + unc-119(+)]. Wild type.
|
|
VT1598 |
C. elegans |
unc-119(ed3) III; maIs227. Show Description
maIs227 [mir-90p::GFP + unc-119(+)]. Wild type.
|
|
VT1600 |
C. elegans |
unc-119(ed3) III; maIs229. Show Description
maIs229 [mir-85p::GFP + unc-119(+)]. Wild type.
|
|
VT1605 |
C. elegans |
unc-119(ed3) III; maIs234. Show Description
maIs234 [mir-53::GFP + unc-119(+)]. Wild type.
|
|
VT1607 |
C. elegans |
unc-119(ed3) III; maIs236. Show Description
maIs236 [mir-246p::GFP + unc-119(+)]. Wild type.
|
|
VT1665 |
C. elegans |
unc-119(ed3) III; maIs251. Show Description
maIs251 [mir-1p::GFP + unc-119(+)]. Wild type.
|
|
VT1673 |
C. elegans |
unc-119(ed3) III; maIs256. Show Description
maIs256 [mir-247-797p::GFP + unc-119(+)]. Wild type.
|
|
VT1702 |
C. elegans |
unc-119(ed3) III; maIs261. Show Description
maIs261 [mir-265p::GFP + unc-119(+)] Wild type.
|
|
VT1709 |
C. elegans |
unc-119(ed3) III; maIs267. Show Description
maIs267 [mir-266p::GFP + unc-119(+)]. Wild type.
|
|
VT1710 |
C. elegans |
unc-119(ed3) III; maIs268. Show Description
maIs268 [mir-259p::GFP + unc-119(+)]. Wild type.
|
|
VT1733 |
C. elegans |
unc-119(ed3) III; maIs276. Show Description
maIs276 [mir-60p::GFP + unc-119(+)]. Wild type.
|
|
VT1735 |
C. elegans |
unc-119(ed3) III; maIs278. Show Description
maIs278 [mir-788p::GFP + unc-119(+)]. Wild type.
|
|
VT1842 |
C. elegans |
unc-119(ed3) III; maIs300. Show Description
maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.
|
|
VT2020 |
C. elegans |
unc-119(ed3) III; maIs347. Show Description
maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.
|
|
VT2021 |
C. elegans |
unc-119(ed3) III; maIs348. Show Description
maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.
|
|
VT2084 |
C. elegans |
unc-119(ed3) III; maIs352. Show Description
maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.
|
|
VT3104 |
C. elegans |
maIs385 I; mir-34(gk437) X. Show Description
maIs385 [lim-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3105 |
C. elegans |
maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3106 |
C. elegans |
maIs387 I; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3107 |
C. elegans |
maIs388 II; mir-83(n4638) IV. Show Description
maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3108 |
C. elegans |
maIs389 II; mir-83(n4638) IV. Show Description
maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3109 |
C. elegans |
maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3110 |
C. elegans |
maIs391 II; mir-83(n4638) IV. Show Description
maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3111 |
C. elegans |
maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3123 |
C. elegans |
maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3124 |
C. elegans |
maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3136 |
C. elegans |
unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3178 |
C. elegans |
unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3294 |
C. elegans |
maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT454 |
C. elegans |
maDf4/dpy-10(e128) unc-104(e1265) II. Show Description
Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
VZ149 |
C. elegans |
vzEx41. Show Description
vzEx41 [dnj-27p(2kb)::dnj-27::dnj-27 3'UTR + unc-122p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
|
|
VZ262 |
C. elegans |
trx-3(tm2820) IV; vzEx96. Show Description
vzEx96 [trx-3p::trx-3::trx-3 3'utr + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
|
|
WBM1438 |
C. elegans |
ieSi57 raga-1(wbm40[raga-1::AID::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
|
|
WH163 |
C. elegans |
nDf29/unc-13(e1091) spd-2(oj29) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.
|
|
WH204 |
C. elegans |
unc-119(ed3) III; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain under normal conditions. Reference: Strome et al. (2001) Mol Biol Cell (6):1751-64.
|
|
WH220 |
C. elegans |
unc-119(ed3) III; ojIs7. Show Description
ojIs7 [zyg-12A::GFP + unc-119(+)].
|
|
WH223 |
C. elegans |
ojIs9. Show Description
ojIs9 [zyg-12(all)::GFP + unc-119(+)].
|
|
WH237 |
C. elegans |
ojIs10. Show Description
ojIs10 [lis-1::GFP + unc-119(+)].
|
|
WH257 |
C. elegans |
unc-119(ed3) III; ojIs5. Show Description
ojIs5 [pie-1p::GFP::dnc-1 + unc-119(+)]
|
|
WH258 |
C. elegans |
unc-119(ed3) III; ojIs57. Show Description
ojIs57 [pie-1::GFP::dnc-2 + unc-119(+)]
|
|
WH259 |
C. elegans |
unc-119(ed3) III; ojIs47. Show Description
ojIs47 [arp-1::GFP + unc-119(+)].
|
|
WH276 |
C. elegans |
unc-119(ed3) III; ojIs13. Show Description
ojIs13 [zyg-12B/C::GFP + unc-119(+)].
|
|