leEx1531 contains [mml-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1533 contains [hlh-3::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1556 contains [hlh-12::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1583 contains [hlh-4::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1601 contains [hlh-8::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1606 contains [aha-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1692 contains [hlh-34::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

leEx1709 [ahr-1::GFP + unc-119(+)]. Superficially wild-type. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

leEx1713 [hlh-17::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. mpk-1(-) strain with germline-specific expression of GFP::MPK-1B. GFP::MPK-1B rescues fertility but the animals are still Vulvaless. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

Heterozygotes are WT and segregate WT and Uncs. 1/3 of the WT are zhp-3(jf61::unc-119+) homozygotes and these lay mostly dead eggs.

jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.

jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

gkDf2. Multiple genes deleted. Deletion extents determined by oligo array CGH. Deletion size: ~44kb. Deletion left flank: TTAGTAAGCCGGAAAATGGATTTCGCTTTTCTCCTATTGAGAAACCTAAA. Deletion right flank: CTACCTTTCAAAATGAATAGCAACCACTTTTTCGACGAAGAAATGTTCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05C4.11, K05C4.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGAAGACGAATCTTTTCGG. External right primer: AAGGACCACCGTCTTCAATG. Internal left primer: ATTAAAGGTGGCCGGAGATT. Internal right primer: GTGGAGGGTCTGATTGGAGA. Internal WT amplicon: 3304 bp. Deletion size: 810 bp. Deletion left flank: AGTCCGTCCCATCGGTACCCGCCGCTCGAA. Deletion right flank: TTTTTAGATCTTGGATTTTACTGGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y6B3A.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok1736 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTTTCACGACGATTTTGGC. External right primer: CAGAGCGACGAAACAAGTGA. Internal left primer: CAACGCTGCGAGAATATCAA. Internal right primer: ACAATGGGTGAAAGTGAGGC. Internal WT amplicon: 2907 bp. Deletion size: 1645 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATGGTTTTCGCAGTTT. External right primer: TGACATGCAGCCTCTAATGG. Internal left primer: ATTCTGCGTCTCCTGCATCT. Internal right primer: AAAAGTGAACACGGCCTTTG. Internal WT amplicon: 2246 bp. Deletion size: 1628 bp. Deletion left flank: AAAAGAGCATCATGCTCTCCGTCACAGCGT. Deletion right flank: TTTTAAAAAAGTTTTGGTTTTTTTTTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y63D3A.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2290 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGCTCCGGATAAACTTGGGT. External right primer: TATTCCCTTCCCACCAATCA. Internal left primer: TTCCAGATGGTGCATTCAAA. Internal right primer: AGACAGGAGCCCGAGATTTT. Internal WT amplicon: 2440 bp. Deletion size: 1264 bp. Deletion left flank: AGCAGATTAAGGTAAGGAGGATTTTGAGCG. Deletion right flank: CCACCACCGCAGGGAGCTCCCCAGCAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39B2.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2597 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAATGCGTACTCGCACTGA. External right primer: GGAAAAGTTCGAGGGGAAAG. Internal left primer: ACGGATTTATTCGGATGGGT. Internal right primer: TACCGGGGAGAGTAAACTGG. Internal WT amplicon: 1302 bp. Deletion size: 727 bp. Deletion left flank: TTATGGTAACACTTTGTGGCGGGACCAATC. Deletion right flank: ATGTACCACGCAATTTCCGTCTGCTGGAAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09C5.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCTCGCTACTACCCGCTA. External right primer: CCCGTGTGTTCTGTTGTTTG. Internal left primer: CAGCCCATCTCTCAAGAAGC. Internal right primer: TCCTCTTCCACGTTTCCATC. Internal WT amplicon: 1106 bp. Deletion size: 565 bp. Deletion left flank: CCTTCTCGAGCACAAGCGCACGCTCAACCT. Deletion right flank: AATAAATAACTGGTTTATGGGTTGAAAATG. Insertion Sequence: CAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 741 bp. Deletion left flank: AAGATACTATCATTCCAGTGAGTATAAAAC. Deletion right flank: TTTGTTCGCGGAATTTTGAGGCTGGAAACT. Insertion Sequence: TATTTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11D2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3030 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTGGCAAATTTTTGATGGC. External right primer: ATTTTCCGCTCGGAATTTTT. Internal left primer: TCTTTCGTGCTTCCAGCTTC. Internal right primer: TTTCTCGTTGATTTTCCCCA. Internal WT amplicon: 1208 bp. Deletion size: 605 bp. Deletion left flank: ATTGGTGGATTTTTCTCCAGAAAGCAGGTG. Deletion right flank: TTCAAAATTTTAGGTCTTGAAATTTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K05C4.1. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3318 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAATCACTCGACTGGGTTG. External right primer: TCCAGATTCACGGATTCTCC. Internal left primer: TATCTCTGCCGAGCTCATCG. Internal right primer: CAATTTTCCCCCATTTGTTG. Internal WT amplicon: 1314 bp. Deletion size: 725 bp. Deletion left flank: ATATCTCTGCCGAGCTCATCGGCAAACTCG. Deletion right flank: ATCTCCGATGTCCAAGATCTTCATGACCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09B9.2. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2640 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCATTTTGGTGACGGTGA. External right primer: AAAGGGCAATGAGTTTGCAC. Internal left primer: AGACGAGATCTGGCATCCAT. Internal right primer: GAGAAGAAGAAAAGGCGCAC. Internal WT amplicon: 1358 bp. Deletion size: 512 bp. Deletion left flank: GCAGAATAAAAATTAAAAAAAAATGTTTAA. Deletion right flank: TTGAATCAGTAGCTGGCTATAGAGCACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09C5.6. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3358 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGTTACCATCAAGGCTCCA. External right primer: ATCGTCCCGTTTTGTGAGTC. Internal left primer: CTTCTGTTCTCCCCCAACCT. Internal right primer: TGCAAGTATGCTCCGTTGAA. Internal WT amplicon: 1101 bp. Deletion size: 640 bp. Deletion left flank: GACGGACACGAACTCTGTATGGAACGTTCT. Deletion right flank: AGTAGGAGCTTTATTTCAGAGAGAAAACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27D9.1. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3477 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGTGGTCTGACATCGAACCT. External right primer: GGGGCTCTGAAAATGAAACA. Internal left primer: GAATTGCTGAACAAATCGCA. Internal right primer: GGGTTGAAATGAGCAATCATC. Internal WT amplicon: 1331 bp. Deletion size: 371 bp. Deletion left flank: TTACTCTTCAAGCAATGTGCTACGACCTTT. Deletion right flank: CAGTATCAACAAGGAGTTGACAAGTTGTGT. Insertion Sequence: AGACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G10A.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3088 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAATTGTTCGGCGAATTTT. External right primer: AAACATTTTCAACCCTGCAAGT. Internal left primer: ATACGTCACCCGAGCAATTC. Internal right primer: CAACCAGAATGCAGAGCAAA. Internal WT amplicon: 1226 bp. Deletion size: 763 bp. Deletion left flank: CCAGTATAGATTGAATAACTTTAAAAATTT. Deletion right flank: AAAATGCTCCACGTACGCATTCTCATGATT. Insertion Sequence: AACTATAGTTATTTAAATTCTTACTGTAGTTTTCGCTAAGTGATATCGCGCGTCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01A2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and gk3070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TAAATATAATACCGTGCGTGCG. External right primer: TCAAAGTCATGTTTCCGTATCG. Internal left primer: GGCTCAGGGTAAATAGACATGG. Internal right primer: TTTAAATGGGTTTGAATCTGGG. Internal WT amplicon: 1458 bp. Deletion size: 510 bp. Deletion left flank: ATTGCAAAAGTGGGCGGGGCGTCGTTTCGT. Deletion right flank: ATCAACTCGATTTTGAGCAAAACTATCTCG. Insertion Sequence: TAGTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W08E3.1. Heterozygotes are WT and segregate WT, Unc hIn1 homozygotes and gk209 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details.

Apparent homozygous lethal or sterile deletion balanced by hIn1[unc-101]. Pick viable fertile GFP+ animals to maintain; hIn1 homozygotes are non-GFP Unc. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAAGTCGAATTTTTAGCCAAAAACCTTAG. Right flanking sequence: GCCGCTCAAATTGCGTATAAAAGGACGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5041 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2264 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT. Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7590 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ACGTTTCCGAGTCACTTTGCTCAAACACCC. Right flanking sequence: AGGAAGTGTAGAAATATTGAATGATGATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C49A1.4. Deletion balanced by unc-101-marked inversion. Heterozygotes are WT and segregate WT, Unc-101 hIn1 homozygotes, and ok654 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53F10.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1246 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807