More Fields
Strain Species Genotype
VT2020 C. elegans unc-119(ed3) III; maIs347. Show Description
maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.
VT2021 C. elegans unc-119(ed3) III; maIs348. Show Description
maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.
VT2084 C. elegans unc-119(ed3) III; maIs352. Show Description
maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.
VT3104 C. elegans maIs385 I; mir-34(gk437) X. Show Description
maIs385 [lim-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3105 C. elegans maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3106 C. elegans maIs387 I; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3107 C. elegans maIs388 II; mir-83(n4638) IV. Show Description
maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3108 C. elegans maIs389 II; mir-83(n4638) IV. Show Description
maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3109 C. elegans maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3110 C. elegans maIs391 II; mir-83(n4638) IV. Show Description
maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3111 C. elegans maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3118 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3123 C. elegans maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3124 C. elegans maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3136 C. elegans unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3145 C. elegans unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3178 C. elegans unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3294 C. elegans maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3500 C. elegans wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT3869 C. elegans wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
VT454 C. elegans maDf4/dpy-10(e128) unc-104(e1265) II. Show Description
Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
VZ149 C. elegans vzEx41. Show Description
vzEx41 [dnj-27p(2kb)::dnj-27::dnj-27 3'UTR + unc-122p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
VZ262 C. elegans trx-3(tm2820) IV; vzEx96. Show Description
vzEx96 [trx-3p::trx-3::trx-3 3'utr + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
WH163 C. elegans nDf29/unc-13(e1091) spd-2(oj29) I. Show Description
Heterozygotes are WT and segregate WT, dead eggs and Uncs. At 25C the Unc Spds are Sterile; at 16C the Unc Spds are fertile but produce mostly dead eggs. Unc Spd animals will exhibit a fully penetrant maternal-effect embryonic lethal phenotype if shifted to 25C at the L4 stage. unc-13 spd-2 homozygotes may be propagated at 16C but may become sick causing immense frustration! See also WBPaper00004200.
WH204 C. elegans unc-119(ed3) III; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain under normal conditions. Reference: Strome et al. (2001) Mol Biol Cell (6):1751-64.
WH220 C. elegans unc-119(ed3) III; ojIs7. Show Description
ojIs7 [zyg-12A::GFP + unc-119(+)].
WH223 C. elegans ojIs9. Show Description
ojIs9 [zyg-12(all)::GFP + unc-119(+)].
WH237 C. elegans ojIs10. Show Description
ojIs10 [lis-1::GFP + unc-119(+)].
WH257 C. elegans unc-119(ed3) III; ojIs5. Show Description
ojIs5 [pie-1p::GFP::dnc-1 + unc-119(+)]
WH258 C. elegans unc-119(ed3) III; ojIs57. Show Description
ojIs57 [pie-1::GFP::dnc-2 + unc-119(+)]
WH259 C. elegans unc-119(ed3) III; ojIs47. Show Description
ojIs47 [arp-1::GFP + unc-119(+)].
WH276 C. elegans unc-119(ed3) III; ojIs13. Show Description
ojIs13 [zyg-12B/C::GFP + unc-119(+)].
WH279 C. elegans unc-119(ed3) III; ojIs12. Show Description
ojIs12 [cyk-4::GFP + unc-119(+)]. Strain is not very healthy. Described as integratred array but appears to segregate Uncs. Maintain at 15-20C.
WH280 C. elegans unc-119(ed3) III; ojEx38. Show Description
ojEx38 [pie-1::GFP::cmd-1 + unc-119(+)]. Reference: Batchelder et al. (2007) FEBS Lett 581(22):4337-41.
WH327 C. elegans unc-119(ed3) III; ojIs23. Show Description
ojIs23 [pie-1p::GFP::C34B2.10].
WH342 C. elegans unc-119(ed3) III; ojIs31. Show Description
ojIs31 [pie-1p::spd-3::GFP + unc-119(+)]. ojIs31 rescues spd-3(oj35) lethality at 25 C. Maintain at 25 C. Reference: Dinkelmann MV, et al., Genetics. 2007 Nov;177(3):1609-20.
WH346 C. elegans unc-119(ed3) III; ojIs34. Show Description
ojIs34 [GFP::car-1 + unc-119(+)]. N'-tagged GFP::CAR-1 (Y18D10A.17) fusion. Labels P-granules and small cytoplasmic puncta in all cells. Bombardment with pNL1.6::GFP::unc-119 (pfj-1::pie-1 promoter driving GFP::Y18D10A.17 (N-terminal) with unc-119 rescuing fragment).
WH347 C. elegans unc-119(ed3) III; ojIs35. Show Description
ojIs35 [pie-1::GFP::rab-11.1 + unc-119(+)].
WH351 C. elegans unc-119(ed3) III; ojIs37. Show Description
ojIs37 [pie-1p::GFP::ugtp-1 + unc-119(+)]. Maintain under normal conditions. Reference: Bembenek J, et al. Development. (2007) 134(21):3837-48.
WH371 C. elegans unc-119(ed3) III; ojIs50. Show Description
ojIs50 [pie-1p::GFP::air-2 + unc-119(+)]. Wild type looking worms with GFP expression in early embryos. GFP can be seen on stereo microscope in complete darkness with sharp eyes.
WH416 C. elegans unc-119(ed3) ojIs58 III. Show Description
ojIs58 [pie-1p::sep-1::GFP + unc-119(+)] III. Maintain under normal conditions. Reference: Bembenek J, et al. Development. (2007) 134(21):3837-48.
WH438 C. elegans unc-119(ed3) III; ojEx64. Show Description
ojEx64 [pie-1p::sep-1::GFP + unc-119(+)]. Pick wild-type. Maintain under normal conditions. Reference: Bembenek J, et al. Development. (2007) 134(21):3837-48.
WH468 C. elegans sep-1(e2406) I/hT2 (I;III); ruIs32 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WH485 C. elegans sep-1(e2406) I/hT2 (I;III); ojIs58 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ojIs58 [pie-1p::sep-1::GFP + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
WH497 C. elegans unc-119(ed3) III; ojIs69. Show Description
ojIs69 [pie-1::mGFP::chin-1 + unc-119(+)]. N-terminal fusion of mGFP to sole predicted BE0003N10.2 ORF. Reference: Kumfer et al. (2010) Mol Biol Cell (2):266-77.
WH498 C. elegans unc-119(ed3) III; ojEx83. Show Description
ojEx83 [pie-1p::mCherry::chin-1a + unc-119(+)]. Maintain by picking wild-type. Check occasionally for maintained mCherry expression.
WH517 C. elegans ojIs40. Show Description
ojIs40 [pie-1::mGFP::wsp-1(G-protein binding domain) + unc-119(+)]. Reference: Kumfer et al. (2010) Mol Biol Cell (2):266-77.
WH527 C. elegans cgef-1(gk261) X; ojIs40. Show Description
ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal condition. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WH528 C. elegans cgef-1(gk261) X; ojIs26. Show Description
ojIs26 [GFP::nmy-2 + unc-119(+)]. Maintain under normal conditions. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WH529 C. elegans cgef-1(gk261) X; ddIs?. Show Description
ddIs? [pie-1p::GFP::par-6 + unc-119(+)]. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.