umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous mid larval arrest. Deletion of 348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve749 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctgaaaaataaaaaatCTATTCCTTTCCGT ; Right flanking sequence: CGGAATTGTTGGATTTGATTGGAGCGACGG. sgRNA #1: aaatCTATTCCTTTCCGTTG; sgRNA #2: CAAATCCAACAATTCCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 4555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead eggs (ve750 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccagtaATGACCGAATCCACAAAATCCGGT ; Right flanking sequence: aattcatgtggaatgtttcagaatgttcac. sgRNA #1: GAATCCACAAAATCCGGTGG; sgRNA #2: aacagagaaatcatgaagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous animals are sick. Deletion of 586 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly larvae (ve751 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cagattaaaaaaaaaacttacTTGGCACCA ; Right flanking sequence: AGGTTTTCGTGAAGGAGCAAACATttttga. sgRNA #1: AAGTACTGTTGTACGCGATG; sgRNA #2: AGTTGATTGGCTGTTGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect embryonic lethal. Deletion of 1394 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Adult worms which lay dead eggs (ve757 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: aaaaaatccacaacttccagATGTCGGCCG ; Right flanking sequence: TGGACAATTGCCAAAAGCTTAAatttcccc. sgRNA #1: AGTGGCGGCGGCGGTTTGAG; sgRNA #2: CTGAGAAAAGCTGAAGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve780 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 2354 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve841 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Left flanking Sequence: TGTGTGATTTGTGATTCACATGTTCGTCCA; Right flanking sequence: AGGATCGTGACGGATGCCCGAAAATTGTGA. phf-5 sgRNA #3: CAGATACGAACCAATGTACA; phf-5 sgRNA #4: AGAATGCACAATTCTCGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CGGAGCCCTTGCTGGTCTTAATATTAGAGT. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5235 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4152 and CGC63. gk5235 is a 2546 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC; Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.