More Fields
Strain Species Genotype
EG8397 C. elegans oxIs322 II; oxTi80 III; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
EG8398 C. elegans oxIs322 II; oxTi80 III; oxSi199 IV; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG II, LG III and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG8760 C. elegans oxIs322 II; oxTi79 III; him-5(e1490) V. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxTi79 [eft-3p::GFP::H2B::tbb-2 3' UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: -26.22. Him. Combined fluorescent balancer strain for LG II and LG III. Strain contains him-5(e1490) to generate males for crosses.
EG8776 C. elegans oxSi255 I; oxIs322 II; oxSi199 IV; him-5(e1490) V. Show Description
oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + ? + Cbr-unc-119(+)] III. Nuclear, red fluorescence in pharynx and body wall muscle. Complex integration into ttTi5605 mosSCI site (II:0.77). oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Him. Combined fluorescent balancer strain for LG I, LG II and LG IV. Strain contains him-5(e1490) to generate males for crosses.
EG9747 C. elegans oxSi1106 II; unc-119(ed3) III. Show Description
oxSi1106 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + lox2272] II. Integrated Cas9 transgene inserted into ttTi5605 MosSci site. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
FT1310 C. elegans avr-14(ad1302) I; xnSi31 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1379 C. elegans avr-14(ad1302) I; xnSi34 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi34 [sec-15::YFP + unc-119(+)] II. Expresses sec-15::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
HS3545 C. elegans osIs158 II; ieSi58 IV. Show Description
osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
IG1839 C. elegans frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749
IG1846 C. elegans frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the inserted vector but outside the genomic rde-1 sequence included in the transgene (jep3108: ATcttgtgaccgaactgtcc) in combination with downstream primer (jep2445: caaaaaggcgggatgagcag), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. Reference: https://www.g3journal.org/content/early/2020/09/17/g3.120.401749
JBL1 C. elegans tonSi1 II; unc-119(ed3) III. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. Maintain at 20-25C. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
JBL2 C. elegans tonSi1 II; unc-119(ed3) III; ddIs6 V. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Maintain at 20-25C. Derived by crossing JBL1 and TH27. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
JBL3 C. elegans tonSi1 II; unc-119(ed3) III; axIs1522. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Maintain at 20-25C. Derived by crossing JBL1 and JH2108. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
JDW313 C. elegans jsSi1579; wrdSi58 II. Show Description
wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
JDW324 C. elegans jsSi1579; wrdSi57 II. Show Description
wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
JK4871 C. elegans fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 C. elegans fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
NM5402 C. elegans jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5500 C. elegans jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
OG472 C. elegans drSi2 II; unc-119(ed3) III. Show Description
drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG474 C. elegans drSi4 II; unc-119(ed3) III. Show Description
drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG496 C. elegans drSi12 II; unc-119(ed3) III. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+) II. Human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules only after prolonged (1 hr) 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG497 C. elegans drSi13 II; unc-119(ed3) III. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules after >1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG528 C. elegans hsf-1(sy441) I; drSi12 II. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG532 C. elegans hsf-1(sy441) I; drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG566 C. elegans drSi28 II; unc-119(ed3) III. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG575 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG580 C. elegans hsf-1(sy441) I; drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG584 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG636 C. elegans drSi41 II; unc-119(ed3) III. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG646 C. elegans hsf-1(sy441) I; drSi41 II. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
QX1409 C. elegans qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
SSM471 C. elegans iowSi8 II; unc-119(ed3) III. Show Description
iowSi8 [pie-1p::GFP(1-10)::him-3 3’UTR + Cbr-unc119(+)] II. Germline-specific split-GFP construct. If germline silencing occurs, transgene expression can be recovered by growing worms at 25°C for 2 generations. iowSi8 was generated by MosSCI insertion into Chr II ttTi5605 in parental strain EG6699. Reference: Hefel A & Smolikove S. G3. 2019 Jun 5;9(6):1933-1943. PMID: 30992318.
STR317 C. elegans hrtSi27 II; unc-119(ed3) III. Show Description
hrtSi27 [des-2p::CRE + unc-119(+)] II. hrtSi27 inserted into ttTi5605. CRE expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
STR473 C. elegans hrtSi57 II; unc-119(ed3) III. Show Description
hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.
SV2061 C. elegans he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
SX1316 C. elegans mjIs144 II; unc-119(ed3) III. Show Description
mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
SX3073 C. elegans mjIs588 II; unc-119(ed3) III Show Description
mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
TMD67 C. elegans mikSi1 II; ltIs38. Show Description
mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256.
WM186 C. elegans avr-14(ad1302) I; ttTi5605 II; unc-119(ed3) III; avr-15(ad1051) glc-1(pk54) V; neEx15. Show Description
neEx15 [myo-2::RFP + myo-2::avr-15(+) + unc-119(+)]. MosSCI recipient strain. neEx15 rescues unc-119, making the worms healthier for injection. The array is counter-selectable. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
WM274 C. elegans prg-1(tm872) I; neSi14 II; unc-119(ed3) III. Show Description
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WM275 C. elegans prg-1(tm872) I; neSi15 II; unc-119(ed3) III. Show Description
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
XW18042 C. elegans qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.