| OD63 |
C. elegans |
unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
|
|
| OD7 |
C. elegans |
unc-119(ed3) III; ltIs3. Show Description
ltIs3[pIC31; pie-1 promoter::hcp-1::GFP-TEV-STag + unc-119(+)].
|
|
| OD76 |
C. elegans |
unc-119(ed3) III; ltIs75. Show Description
ltIs75 [(pSK5) pie-1::GFP::TEV-STag::LacI + unc-119(+)].
|
|
| OD8 |
C. elegans |
unc-119(ed3) III; ltIs4. Show Description
ltIs4 [(pIC32) pie-1p::mis-12::GFP::TEV-STag + unc-119(+)].
|
|
| OD9 |
C. elegans |
unc-119(ed3) III; ltIs5. Show Description
ltIs5 [(pIC36) pie-1p::kbp-1::GFP::TEV-STag + unc-119(+)].
|
|
| OH14130 |
C. elegans |
che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.
|
|
| OH15579 |
C. elegans |
che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
|
|
| OH15683 |
C. elegans |
che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
|
|
| OH15815 |
C. elegans |
che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
|
|
| OH15876 |
C. elegans |
pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| OH19945 |
C. elegans |
pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.
|
|
| PHX5755 |
C. elegans |
pha-4(syb5755[pha-4::3xGAS::GFP::3xGAS::AID*::TEV::LoxP::3xFLAG] *ot1078 *ot946) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| RDV55 |
C. elegans |
rdvIs1 III. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
| RDV83 |
C. elegans |
rdvIs1 III; zuIs45 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
| RDV84 |
C. elegans |
rdvIs1 III; ddIs6 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
|
|
| RJP5269 |
C. elegans |
unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635
|
|
| RJP5296 |
C. elegans |
reSi7 I; unc-31(rp166[GFP::TEV::AID*::FLAG::unc-31]) IV. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| SA1016 |
C. elegans |
tba-2(tj38[gfp::TEV::3×FLAG::tba-2]) I. Show Description
GFP tag inserted into the endogenous tba-2 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.
|
|
| SA1067 |
C. elegans |
tba-1(tj44[gfp::TEV::3×FLAG::tba-1]) I. Show Description
GFP tag inserted into the endogenous tba-1 locus. GFP signals are detected at the epidermis, germline, intestine, muscle, and neurons. Reference: Honda Y, et al. J. Cell. Sci. 2017 May 1;130(9):1652-1661. PMID: 28302908.
|
|
| SA1171 |
C. elegans |
tba-4(tj63[gfp::TEV::3xFLAG::tba-4]) II. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-2 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1176 |
C. elegans |
tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1180 |
C. elegans |
mec-12(tj70[gfp::TEV::3xFLAG::mec-12]) III. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous mec-12 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1205 |
C. elegans |
tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1208 |
C. elegans |
mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous mec-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1280 |
C. elegans |
tbb-6(tj80[gfp::TEV::3xFLAG::tbb-6]) V. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tbb-6 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1303 |
C. elegans |
tba-9(tj100[gfp::TEV::3xFLAG::tba-9]) X. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-9 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1358 |
C. elegans |
tba-5(tj102[gfp::TEV::3xFLAG::tba-5]) I. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-5 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1378 |
C. elegans |
ben-1(tj87[gfp::TEV::3xFLAG::ben-1]) III. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous ben-1 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1386 |
C. elegans |
tba-6(tj105[gfp::TEV::3xFLAG::tba-6]) I. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-6 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| SA1430 |
C. elegans |
tba-8(tj108[gfp::TEV::3xFLAG::tba-8]) X. Show Description
GFP::TEV::3xFLAG tag inserted into the endogenous tba-8 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
|
|
| VS29 |
C. elegans |
hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
|
|
| WHY430 |
C. elegans |
attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II. Show Description
wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.
|
|
| GT332 |
C. elegans |
aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3UTR::Split 3 HygR::tjp2a_guide::Split 3 mScarlet-I::egl-13nls::tbb-2 3UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| GT337 |
C. elegans |
aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3 (delta)HygR + 3 (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| JU1652 |
C. elegans |
C. elegans wild isolate. Show Description
Isolated by Rosina Giordano from compost sampled in Montevideo, Uruguay. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| PX696 |
C. elegans |
fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
|
|
| PX740 |
C. elegans |
fxIs47 II. Show Description
fxIs47 [rps-0p::5 (delta)HygR::GCGAAGTGACGGTAGACCGT::3 (delta)HygR::unc-54 3::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|