More Fields
Strain Species Genotype
UP148 C. elegans sem-5(cs15) X. Show Description
Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.
WY114 C. elegans pha-1(fd1) III. Show Description
Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.
WY184 C. elegans xnp-1(fd2) I. Show Description
WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.
WY34 C. elegans ubc-18(ku354) III. Show Description
Synthetic with lin-35. Slightly reduced growth rate. Reduced brood size. Otherwise appears wild-type.
ZT57 C. elegans csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
SP2230 C. elegans sym-2(mn617) II. Show Description
Wild type. Synthetically lethal with mec-8.
SP2231 C. elegans sym-3(mn618) X. Show Description
Wild type. Synthetically lethal with mec-8.
SP2232 C. elegans sym-4(mn619) X. Show Description
Wild type. Synthetically lethal with mec-8.