AMH36 |
C. elegans |
juIs76 II; daf-2(e1370) III; unc-33(mn407) IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C.
|
|
AMH46 |
C. elegans |
juIs76 II; daf-2(e1370) III; unc-33(e1193) IV. Show Description
Maintain at 15C. Synthetic Lethality at 25C. Unc; almost paralyzed. Growth slow.
|
|
AMH67 |
C. elegans |
unc-33(e204) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
|
|
AMH69 |
C. elegans |
unc-33(mn407) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
|
|
AMH71 |
C. elegans |
unc-33(e1193) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
|
|
CB502 |
C. elegans |
sma-2(e502) III. Show Description
Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.
|
|
CER522 |
C. elegans |
ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
DLM16 |
C. elegans |
ubc-18(tm5426) sup-35(e2215) pha-1(e2123) III. Show Description
sup-35 rescues synthetic lethality of ubc-18 and pha-1.
|
|
DLM18 |
C. elegans |
ubc-18(tm5426) III; sup-36(e2217) IV. Show Description
sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
DLM19 |
C. elegans |
ubc-18(tm5426) III; sup-37(e2215) V. Show Description
DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
IC361 |
C. elegans |
vab-1(e2)/mIn1 [dpy-10(e128) mIs14] II; sax-3(ky123) X. Show Description
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.
|
|
JC1225 |
C. elegans |
mrp-1(ut153) X. Show Description
Synthetic Daf at 15C when in an unc-31(e169) background.
|
|
JC1970 |
C. elegans |
tbx-2(ut180) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
|
|
JC1971 |
C. elegans |
tbx-2(ut192) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
|
|
JH1270 |
C. elegans |
nos-1(gv5) II. Show Description
No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
|
|
JIM220 |
C. elegans |
ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
|
|
JM311 |
C. elegans |
lem-2(ca19) II. Show Description
Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.
|
|
JW106 |
C. elegans |
sup-39(je5) II; syr-1(je11) ?. Show Description
Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.
|
|
LP316 |
C. elegans |
hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
MH1829 |
C. elegans |
fzr-1(ku298) unc-4(e120) II. Show Description
Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35.
|
|
MH2354 |
C. elegans |
swsn-1(ku355) V. Show Description
Synthetic lethal with lin-35(n745). Temperature sensitive.
|
|
MT111 |
C. elegans |
lin-8(n111) II. Show Description
WT phenotype. Synthetic Muv.
|
|
MT112 |
C. elegans |
lin-9(n112) III. Show Description
WT. Synthetic Muv with lin-8 or lin-38.
|
|
MT14761 |
C. elegans |
lin-53(n833) I. Show Description
Superficially wild-type. Synthetic Muv with lin-15A(n767).
|
|
MT1624 |
C. elegans |
lin-35(n745) I; lin-8(n111) II. Show Description
Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.
|
|
MT1628 |
C. elegans |
lin-9(n112) III; lin-15A(n749) X. Show Description
Synthetic Muv. n749 is lin-15 Class A allele.
|
|
MT1630 |
C. elegans |
lin-38(n751) II; lin-9(n112) III. Show Description
Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.
|
|
MT1806 |
C. elegans |
lin-15A(n767) X. Show Description
WT phenotype. Synthetic Muv.
|
|
MT6034 |
C. elegans |
lin-36(n766) III. Show Description
WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).
|
|
MT664 |
C. elegans |
lin-8(n111) II; lin-15B(n374) X. Show Description
Synthetic Muv.
|
|
MT8840 |
C. elegans |
dpy-5(e61) lin-53(n833) I. Show Description
Dpy. n833 is a synthetic Muv with lin-15A(n767).
|
|
MT8879 |
C. elegans |
dpl-1(n2994) II. Show Description
Synthetic Muv B.
|
|
MT990 |
C. elegans |
lin-9(n112) III; lin-15A(n433) X. Show Description
Synthetic Muv. n433 is lin-15 Class A allele.
|
|
NK2583 |
C. elegans |
unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
|
|
NK2643 |
C. elegans |
lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
PS2366 |
C. elegans |
itr-1(sy328) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2368 |
C. elegans |
itr-1(sy327) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2512 |
C. elegans |
itr-1(sy331) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2516 |
C. elegans |
itr-1(sy291) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2582 |
C. elegans |
itr-1(sy290) unc-24(e138) IV. Show Description
Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PX696 |
C. elegans |
fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
|
|
QP1208 |
C. elegans |
sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
|
|
RM2576 |
C. elegans |
cho-1(tm373) IV. Show Description
Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
|
|
RM3218 |
C. elegans |
pha-1(e2123) III; cho-1(tm373) IV; mdEx790. Show Description
mdEx790 [cho-1p(7.6kb)::cho-1::GFP + pha-1(+) + pBluescript]. CHO-1 translational fusion driven by 7.6 kb cho-1 promoter rescues cho-1 mutant behaviors, including reduced initial thrashing rate, fatigue, and synthetic interactions with pmt-2. Strong fluorescence in nerve ring, and ventral and dorsal nerve cords. Structure of the transgene is shown in Figure 1 of Mullen et al., 2007.
|
|
UP148 |
C. elegans |
sem-5(cs15) X. Show Description
Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.
|
|
WY114 |
C. elegans |
pha-1(fd1) III. Show Description
Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.
|
|
WY184 |
C. elegans |
xnp-1(fd2) I. Show Description
WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.
|
|
WY34 |
C. elegans |
ubc-18(ku354) III. Show Description
Synthetic with lin-35. Slightly reduced growth rate. Reduced brood size. Otherwise appears wild-type.
|
|
ZT57 |
C. elegans |
csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
SP2230 |
C. elegans |
sym-2(mn617) II. Show Description
Wild type. Synthetically lethal with mec-8.
|
|