More Fields
Strain Species Genotype
PS9809 C. elegans C01G6.4(sy1916) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C01G6.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGGTTCGTCAGACAGCACGATGAGACGCCACTA. Right flanking sequence: CGACGgtaatttactttgtcattcactagtatactg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGATGAGACGCCACTACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.