| asp-12(sy1899) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|