More Fields
Strain Species Genotype
PS9485 C. elegans col-36(sy1783) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-36. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTTGCGGTTGCTGTCTCAACTGCAGCCGTCATT right flanking sequence: TCAAGgtaattaaaaacttcactcttcagattatc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAACTGCAGCCGTCATTTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616