More Fields
Strain Species Genotype
PS1410 C. elegans let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
AML597 C. elegans lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML614 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML617 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML618 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML622 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML659 C. elegans acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821.
PS611 C. elegans mab-21(sy155) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS8741 C. elegans lgc-44(sy1500) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-44. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCTATTTCTCTTCTTTTTCTAATATTTCCACAT right flanking sequence: TCATCTAATCCTTCAAGCTCTAATTTTCTGGATATTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTGAAGGATTAGATGAATG Method Reference: G3 (Bethesda).
PS8742 C. elegans lgc-47(sy1501) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCCACATTGTTTCTGTTGCTCTATGCCACCCGGG right flanking sequence: AAACGGTCAATGCAATGACTGCCGAGATCAGCCC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGCATTGACCGTTTCCC Method Reference: G3 (Bethesda).
PS8743 C. elegans lgc-36(sy1502) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCGGAAGTTTTCGTATAAAACGAACTGTTCACCCT right flanking sequence: AAAAGgtaagtaaccatctaattcaactattttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACGAACTGTTCACCCTAAA Method Reference: G3 (Bethesda).
PS8745 C. elegans lgc-7(sy1504) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTTATTATCAATATTTCAATGAATACCATGT right flanking sequence: CTGTTCTAACACTAGATCCTGCTGAAGAAACCATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATCTAGTGTTAGAACAGACA Method Reference: G3 (Bethesda).
PS8747 C. elegans lgc-48(sy1506) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-48. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagcttcATGTTTTTTCATATTTTTTTGGGCCTACT right flanking sequence: GGTCGCTGTTTTGGGTGAAGAAGTTCATGAACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACCCAAAACAGCGACCAGT Method Reference: G3 (Bethesda).
PS8749 C. elegans lgc-8(sy1508) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGGTATCAGAGCAGTTGAAGGATGTTCTTATGGAA right flanking sequence: Ggttggtattgatttagttcaccaaaaagagtttag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGGATGTTCTTATGGAAGGT Method Reference: G3 (Bethesda).
PS8751 C. elegans otpl-1(sy1510) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGCACTGTTCTTAACCATTTTCTCACTGGTACTCG right flanking sequence: AGCTGGCTCACTTGCTCAATGATGAGGAATCCCGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTCACTGGTACTCGAGC Method Reference: G3 (Bethesda).
PS8779 C. elegans col-88(sy1512) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-88. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCCTTATCGGTACCCAGGTGATCCTCTCCACCG right flanking sequence: CTATCCTTGGCTCCCTGCTCTACGCCGGTGTCCTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CAGGGAGCCAAGGATAGCGG Method Reference: G3 (Bethesda).
PS8785 C. elegans ZK637.2(sy1518) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZK637.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CGATGAGATGATTGACGATTTGGATAAGACCTATT right flanking sequence: TGAGGGATATGCAGAAGAGCATGTTTCAGTGCTCAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTCTGCATATCCCTCAAAT Method Reference: G3 (Bethesda).
PS8787 C. elegans col-81(sy1520) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda).
PS8789 C. elegans dmsr-1(sy1522) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTATACATGCCTACTTATCAATATTTCTATGCGT right flanking sequence: GTTGGGTACAATCGCTAATTTCTGTAACATCGTCG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATATTTCTATGCGTGTT Method Reference: G3 (Bethesda).
PS8819 C. elegans col-120(sy1526) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-120. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTCTGGAATCATGTGCATTATTCTAATTCCTGGG right flanking sequence: CTTTACACATATCTACAATATATTCAAAGCTCTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTAGATATGTGTAAAGCCC Method Reference: G3 (Bethesda).
PS8821 C. elegans col-129(sy1528) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-129. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ccgtctggcaccaaatgATGACTGTTGTCCCACA right flanking sequence: AGGAGGCAAGCAACGTCAAGTCTACGAGTCCCTGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGACTGTTGTCCCACAAGG Method Reference: G3 (Bethesda).
PS8822 C. elegans col-137(sy1529) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-137. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATCGCAATTTCCACGATTGCAACTCTGACCGCTA right flanking sequence: TCTTGGCAATTCCAATGTTGTACAATTACATGCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACTCTGACCGCTATCT Method Reference: G3 (Bethesda).
PS8823 C. elegans dmsr-6(sy1530) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ggaatacttactaatttaaaatttttagCCTATA right flanking sequence: CTCTAACGTTCATCCTTTCTTGTCATTCATCCTATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGGATGAACGTTAGAGTAT Method Reference: G3 (Bethesda).
PS8825 C. elegans clec-47(sy1532) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-47. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTCATTTTTGTACTTGCAATTTTTATATTTCCAATT right flanking sequence: GCTTCAATTTCGTGTCCAAGTGGCTTTACACTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGACACGAAATTGAAGCAAT Method Reference: G3 (Bethesda).
PS8827 C. elegans col-139(sy1534) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-139; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTTACCGATTCATTGCCTACTCGGCAGTTACAC Right flanking sequence: TTTCGGTTGCTGCAGTTTTTGGGgtaagtttcagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTACTCGGCAGTTACACTTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8829 C. elegans col-156(sy1536) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-156; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGAACACGTTCATCGCTGGACTCACCACTGT Right flanking sequence: ATCCGGTGTAGCGATTCTCGGATGTCTTTTGTTTTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTGGACTCACCACTGTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8854 C. elegans dmsr-7(sy1539) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8856 C. elegans dmsr-8(sy1541) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATATTCATCCGTACGTCTCTGTGATTCTCTGTCT Right flanking sequence: TGCAGgttggttattatgaagtgatcgcacatgttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTGTGATTCTCTGTCTTGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8858 C. elegans dmsr-3(sy1543) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACAACGGTATTCGAGACGTTTCTCCTCGAATAT Right flanking sequence: GGGAGGATAATTCACCCGCCGATGGTCCTACTTTTATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGTTTCTCCTCGAATATGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8860 C. elegans dmsr-4(sy1545) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGGAACACTGTTCGACCCGCAGGATCCCGCAG Right flanking sequence: TTTCTGGCCTCATCGATGCTCTCGAGCAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCGATGAGGCCAGAAACTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8861 C. elegans dmsr-9(sy1546) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATATTTTAGCCAATATCCGGAAGCCAATAGTG Right flanking sequence: ACGAGGCAAAAGATTTGTTTATTACTTCATTGATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGGAAGCCAATAGTGACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8863 C. elegans dmsr-10(sy1548) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAGTGGCCAGATCCAGAAACTGGAGATGCTAAGG Right flanking sequence: ACTTGGTTATTTCTCAATTTATTAATACAGTTGTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AACTGGAGATGCTAAGGACT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8865 C. elegans lgc-42(sy1550) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-42; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAATGGAAATCCGAAGGCTCCGCTGCAAGTGCA Right flanking sequence: CTTTGGTTTTTATGTGGAGAGCTTGGGAAATTTCAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCCGCTGCAAGTGCACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8882 C. elegans dmsr-11(sy1551) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-11; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTGAGGCTGCAATTAATAACGGAATTGTTTCCTTCA Right flanking sequence: TGGACGCATTAGTAAAgtaatttaaactttagc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTACTAATGCGTCCATGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8884 C. elegans dmsr-14(sy1553) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-14; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGTTTATTGCTGTTAGTGATTTCGGATGTGCAGT Right flanking sequence: TACTGGTTTGATGCAATTATTTATAAGAAATTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GATTTCGGATGTGCAGTTAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8886 C. elegans gnrr-1(sy1555) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of gnrr-1; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCAATGATTCTGTTCTATCAATTGTCTTCACAT Right flanking sequence: ATTTGGCTTTATTTATTCTGGCATTTGTTGGAAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATCAATTGTCTTCACATATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8888 C. elegans dmsr-5(sy1557) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgaaaaaaatggttgcagGGTCTACACAGTATTG Right flanking sequence: CATCGGTATTTATGTCTTTTTGTGTGTTTTTTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGGTCTACACAGTATTGCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8890 C. elegans dmsr-12(sy1559) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-12; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGCCGTTTCACTACTATATATTCACTTCCTTAG Right flanking sequence: TTGTTTTGCATTTTTTGCAAATATTATGATTGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAAAAAATGCAAAACAACTA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8892 C. elegans dmsr-13(sy1561) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-13; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTGTGCCATATCCGGAGCCGGGCACCGATGAA Right flanking sequence: GTTGGGAATAGCACGATTCCATGGTTGATTACTAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGCCGGGCACCGATGAAGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8894 C. elegans dmsr-15(sy1563) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-15; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: AAAAAACATGTCAGAAAATAAAAATCGCGGAGATA Right flanking sequence: TTTCGGATTGTCAACAAAATTTGCTCGATTCAAATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAAAATCGCGGAGATATTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8896 C. elegans dmsr-16(sy1565) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAAGTTTCTTTGCAAATGCTCTTATCGCTATAG Right flanking sequence: TTCTGGCAAACAAGGTTATGAGGATTTCTGGAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGCTCTTATCGCTATAGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8897 C. elegans oac-21(sy1566) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-21. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CACAAAAATCTTCAAAACGACTAGATCTTCAAGGC right flanking sequence: ATCCGGGCTCTCGCTATTCTAGTTGTTCTTGGCTTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACTAGATCTTCAAGGCATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8900 C. elegans sprr-2(sy1569) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of sprr-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGTTTATTGCGGCAATGCGCATGCAGAGCCAAAT Right flanking sequence: AGCTCAGCAGTTCAACAACTTGCAGAAGCATGTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTGAACTGCTGAGCTATT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8902 C. elegans npr-6(sy1571) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtaatttttattttaaaaaaacacgtttcagAACC right flanking sequence: CCATGGAAATGGAATATTTCCGCCCATTCTTTATTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACGTTTCAGAACCCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8934 C. elegans oac-30(sy1577) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-30; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gtaattttgaaacttgctgaaattttcagATTCCGCCG Right flanking sequence: AATCCTGCCACTCTACTATCTCCTCATCTTCTTAA inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGTAGAGTGGCAGGATTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8936 C. elegans otpl-2(sy1579) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CATGAAAATATGAAACGTTGGACGAAAAACCCGGAA Right flanking sequence: GCAAGgtaaaaagggaataactcaatataattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGACGAAAAACCCGGAAGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8938 C. elegans frpr-12(sy1581) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GATTTTCCAACTTCTAATGTTCAAAGTTACACCTTGA right flanking sequence: ATGAAGTGTTTTCAATGGTTATGCTACCAATTATT inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATTGAAAACACTTCATTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8940 C. elegans otpl-3(sy1583) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCGTCAAATTGTTCTACAATTGCAACACCCAAC Right flanking sequence: AGCAAAGTCAGATTTCGGTATCATGAGAAACGATATTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CGAAATCTGACTTTGCTGTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8942 C. elegans otpl-4(sy1585) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-4 ; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTCAATTGTTTTTTATATTATTCTGGGACTGACA Right flanking sequence: TCGTGGAAAAAGgtgagaatagcaagatttattc inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TTATTCTGGGACTGACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8943 C. elegans otpl-5(sy1586) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-5; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGAGAGCACAAGCACATCGGTAGCAATGTCCACAT Right flanking sequence: CAGACGGGTTCAGTAGCCATGACGATATTTCACAATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTACTGAACCCGTCTGATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616