More Fields
Strain Species Genotype
PS8544 C. elegans clec-87(sy1396) I. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clec-87. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTTTTTGCCTTCTCGTTGCTTTCATCCTTCCTGGG right flanking sequence: CTATTCCTCGTTCATGCAGCTCCGACTTCTTCAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCATGAACGAGGAATAGCCC Method Reference: G3 (Bethesda).