F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ieSi65 [sun-1p::TIR1::sun-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

Unc. bs12 mutation causes sublethal defect in attachment of centrosome to the nucleus in early embryos. Viable 15-25 C. Reference: Kemp et al. (2007) Genetics 176:95-113.

ieSi21 [sun-1::mRuby] IV. Homozygous animals developed normally, their self-progeny showed reduced viability, and many survivors were males (8%).

F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.

bs12 and bs53 partially suppress zyg-1. Grow at 20C.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923

ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.

hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. Reference: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.