ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.

pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.

mnEx2 [mec-8(+) + rol-6(su1006)]. Rollers. Pick rollers to maintain.

mnEx171 [dyf-6::GFP + rol-6(su1006)]. Reference: Bell LR, et al. Genetics 2006 173: 1275-1286.

ncIs1 [eat-20::GFP + rol-6(su1006)]. Rollers.

ncEx3003 [hsp16-2p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3026 [aex-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3031 [myo-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx3034 [F25B3.3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.

ncEx9005 [lin-32p::FLAG::let-363 + lin-32p::Myc::daf-15 + lin-32p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing lin-32p followed by the FLAG-, Myc- and HA-coding sequences to generate lin-32p::FLAG::let-363, lin-32p::Myc::daf-15 and lin-32p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ncEx9007 [unc-54p::FLAG::let-363 + unc-54p::Myc::daf-15 + unc-54p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing inserted into pPD30.38 containing unc-54p followed by the FLAG-, Myc- and HA-coding sequences to generate unc-54p::FLAG::let-363, unc-54p::Myc::daf-15 and unc-54p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ncEx9013 [lin-32p::FLAG::h4EBP1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to h4EBP1 cDNA and inserted into pPD49.26 containing lin-32p followed by the FLAG-coding sequence to generate in-32p::FLAG::h4EBP1. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Heterozygotes are Rollers and segregate Rollers, Hmr inviable embyros and Egl Unc. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

jcEx44 [ajm-1::GFP + rol-6(su1006)]. Throws Rollers (weak -- some animals appear nearly wild-type) expressing ajm-1::GFP and dead eggs.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. itr-1(jc5) is cold sensitive. Progeny of homozygotes reared at 15C exhibit 95% maternal effect lethality, while progeny of homozygotes reared at 20C exhibit 15.2% lethality. Arrested embryos are defective in epithelial morphogenesis. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4.

jcIs17 [hmp-1p::hmp-1::GFP + dlg-1p::dlg-1::DsRed + rol-6(su1006)]. Rollers. References: Zaidel-Bar R, et al. J Cell Biol. 2010 Nov 15;191(4):761-9. Raich WB, et al. Curr Biol. 1999 Oct 21;9(20):1139-46.

jcIs25 [pPE103 (jac-1::GFP) + rol-6(su1006)]. Rollers. Reference: Pettitt et al. 2003. LCB 162:15-22.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

chEx1682 [pLH070(qua-1(full-length)::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions; pick rollers. Reference: Hao et al. (2006) Dev Dyn 235:1469-81.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Many animals roll weakly or not at all, but still express GFP. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll well, but GFP expression is easily detected. Reference: Nass R, et al. Proc Natl Acad Sci U S A. 2002 Mar 5;99(5):3264-9. Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. [NOTE: tsp-17(tm4995) is the correct allele carried in this strain. The genotype was annotated incorrectly in Masoudi N, et al. (S. Mitani, 11/2016)] Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.

zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

yIs2 [xol-1::lacZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.

yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.

yIs34 [(pMN15.1) xol-1::GFP + rol-6(su1006)]. Pick Rollers. xol-1::GFP translational fusion with sXO-specific expression. Strain gives some non-Rollers, which represent silenced arrays.

yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion.

yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.

cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.

cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.

baEx2 [lis-1::GFP + rol-6(su1006)]. Maintain by picking Rollers.

baEx46 [nud-1::lacZ + rol-6(su1006)]. Maintain by picking Rollers.

baIs13 [nud-1::GFP + rol-6(su1006)]. Rollers.

leIs1 [pes-1::lacZ + rol-6(su1006)] V. Rollers. B-galactosidase expression begins in a subset of cells of the AB lineage which go on to produce muscle, nerve and hypodermal cells. B-galactosidase is also present within the D lineage until the cells move anteriorly to become body wall cells. Expression is also apparent in Z1 and Z4 which go on to form part of the somatic gonad. plasmid name: pUL#24C7. Plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.