qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 25C. itIs153 is an integrated derivitive of axEx1094.

huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.

huIs4 [hsp-16.2p::pop-1(delta N) + rol-6(su1006)]. Rollers. Truncated pop-1 fragment encoding delta N-POP-1(45-438) driven by heat-shock promotor hsp-16.2. Reference: Korswagen et al. (2000) Nature 406: 527-32.

huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.

hEx10 [C12H4 + M01A12 + C07F10 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 57% Unc Rollers. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx15 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 39% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx26 [C07F10 + C04F1 + C53A11 + rol-6(su1006)]. Maintain by picking Unc Rollers. Segregates 53% Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx16 [C32E7 + rol-6(su1006)]. Segregates 65% Unc Rollers. Semi-sterile: high sterility rate and low brood size. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx30 [C12H4 + M01A12 + C07F10 + rol-6(su1006)]. Line 2. Maintain by picking UncRollers. Segregates Uncs and UncRollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx33 [F40D12 + M01E11 + C12H2 + rol-6(su1006)]. Line 1. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hEx44 [C53A11 + C03E6 + C30B6 + rol-6(su1006)]. Maintain by picking Unc Rollers. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).

ldIs7 [skn-1b/c::GFP + rol-6(su1006)]. Rollers. Reference: An JH and Blackwell TK. Genes Dev. 2003 Aug 1;17(15):1882-93.

ldEx9 [skn-1(operon)::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: Tullet JM, et al. Cell. 2008 Mar 21;132(6):1025-38.

ldIs3 [gcs-1p::GFP + rol-6(su1006)]. Rollers. Reference: Wang J, et al. PLoS Genet. 2010 Aug 5;6(8). pii: e1001048.

ldEx1050 [pcst-1p::pcst-1::GFP +rol-6(su1006)]. Maintain by picking Rollers. Reference: Lehtinen MK, et al. Cell. 2006 Jun 2;125(5):987-1001.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain replaces LG100. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

geIs7 [skn-1b::GFP + rol-6(su1006)]. Rollers. Reference: Nature (2007) 447(7144):545-9.

geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.

geIs8 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Reference: Nature (2007) 447(7144):545-9.

geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.

geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain contains the transgene from LG100 crossed away from a linked dyf mutaion. Reference: Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

geIs101 [rol-6(su1006)]. Rollers. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.

qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Maintain at 15C. ~30% animals form dauers at 20C. Not all animals will roll, but all should be GFP+. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

sqEx4 [atg-18p::atg-18::GFP + rol-6(su1006)]. Pick GFP+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

sqEx9 [argk-1p::argk-1::mCherry + rol-6(su1006)]. Pick mCherry+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

stEx30 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. Pick GFP+ Rollers to maintain. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

sqIs19 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. [NOTE: the array does not segregate 100% in original stock; pick GFP+ and check for correct segregation to maintain the array. New stock recevied at CGC June, 2016.] Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

sqIs17 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. Derived from JIN1679. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

sqIs25 [atg-18p::atg-18::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx4 in MAH145. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

sqEx27 [sur-5p::argk-1::GFP + rol-6(su1006)]. Pick GFP+ Rollers to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

sqIs32 [sur-5p::argk-1::GFP + rol-6(su1006)]. GFP+ Rollers. Derived by integration of sqEx27 in MAH264. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. mgEx779 [lipl-4p::lipl-4::SL2::GFP + myo-2p::mCherry]. Pick RFP+ Rollers to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx82 [argk-1p::GFP + rol-6(su1006)]. Pick Rollers with GFP expression in nerve ring and posterior intestine to maintain. Reference: McQuary et. al., Cell Report. 2016 doi: 10.1016/j.celrep.2016.02.012.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.