More Fields
Strain Species Genotype
CHS1104 C. elegans srv-5(yum1602) srv-6(yum1603) srv-7(yum1604) X; srv-8(yum1605) srv-9(yum1606) srv-10(yum1607) c34b4.3(yum1608) V; b0563.6(yum1609) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9458 C. elegans srv-8(sy1771) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTTATTTTGTAGAAATACAAATTTTATTCACT right flanking sequence: TCGAGGAATTCTACTTTCAAAGgtcagagaagata inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAATTTTATTCACTTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
OH14752 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6855. Show Description
otEx6855 [srv-8p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.