Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1247 C. elegans srh-10(yum2523) srh-15(yum2524) srh-16(yum2525) srh-18(yum2526) srh-17(yum2527) srh-11(yum2528) srh-20(yum2529) srh-21(yum2530) srh-22(yum2531) srh-23(yum2532) srh-19(yum2533) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1008 C. elegans srh-213(yum1140) srh-212(yum1139) srh-218(yum1141) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1033 C. elegans srh-127(yum1249) srh-211(yum1250) srh-212(yum1255) srh-213(yum1256) srh-214(yum1251) srh-215(yum1252) srh-216(yum1253) srh-217(yum1254) srh-218(yum1257) srh-219(yum1258) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OH14313 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6674. Show Description
otEx6674 [srh-210p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14315 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6676. Show Description
otEx6676 [srh-211p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14317 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6678. Show Description
otEx6678 [srh-218p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
VC1480 C. elegans srh-215(gk673) V/nT1 [qIs51] (IV;V). Show Description
T20B3.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk673 homozygotes (sterile adult, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGACGATCAGGAATGGGA. External right primer: AAAGCGGAAAGTGGGAAAGT. Internal left primer: GCCAAGAACCAAACTTCCAA. Internal right primer: CGATTTCCACGTACTGAGCA. Internal WT amplicon: 2225 bp. Deletion size: 958 bp. Deletion left flank: TAAGAATCTGACTTTCATTTCGGCTTGCAA. Deletion right flank: GCCCGTTTTGGCAATGATAATTGCTTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4299 C. elegans srh-216(gk5382[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2643 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATTCCCAAATTGTTCCTCCCAAAACCTCCC; Right flanking sequence: TGGGGTCGTGAAGAAGCTAAGTGATAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.