| CHS1022 |
C. elegans |
srg-2(yum1183) srg-5(yum1184) srg-6(yum1185) srg-7(yum1186) srg-8(yum1187) srg-9(yum1188) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| PS9464 |
C. elegans |
srg-6(sy1777) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: ATTTCAAAAATGATTTACGTGATACAAGTGAAACA right flanking sequence: TCGAGGTGATTATCATGAACAGAGGCGGTTTTGG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGATACAAGTGAAACATCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| CHS1034 |
C. elegans |
srg-65(yum1267) srg-66(yum1268) srg-67(yum1269) srg-68(yum1270) V; srg-56(yum1259) srg-57(yum1260) srg-58(yum1261) srg-59(yum1262) srg-60(yum1263) srg-61(yum1264) srg-62(yum1265) V; srg-64(yum1266) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1096 |
C. elegans |
srg-69(yum1553) II; srg-3(yum1554) srg-4(yum1555) III; srg-38(yum1550) srg-54(yum1551) srg-55(yum1552) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| OH14250 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6626. Show Description
otEx6626 [srg-66p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH15128 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx7020. Show Description
otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| RB2627 |
C. elegans |
srg-69(ok3686) II. Show Description
F09E5.4 Homozygous. Outer Left Sequence: acatgttgtgcagcattggt. Outer Right Sequence: gcaaagatatcgtggctggt. Inner Left Sequence: gcgacctacggcaaaattag. Inner Right Sequence: gcaacagaaaccattctagcac. Inner Primer PCR Length: 1264. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|